EMAIL THIS PAGE TO A FRIEND

TXNL4B

thioredoxin-like 4B

Synonyms: DLP Dim2
UniProtKB ID: Q9NX01, D3DWS6
Gene ID:
Mouse(234723) thioredoxin-like 4B
Rat(292008) thioredoxin-like 4B
domestic guinea pig(100736217) thioredoxin-like 4B
naked mole-rat(101705362) thioredoxin-like 4B
cow(510719) thioredoxin-like 4B
sheep(101102004) thioredoxin-like 4B
Zebrafish(641329) thioredoxin-like 4B
domestic cat(101100104) thioredoxin-like 4B
dog(612963) thioredoxin-like 4B
chicken(418396) thioredoxin-like 4B
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017853 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017853 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017853 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175646 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175646 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175646 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017853 Rosetta Predictions human pricing
NM_001013891 Rosetta Predictions rat pricing
NM_175646 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017853 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350749 predicted 618
2 SASI_Hs02_00350750 predicted 724
3 SASI_Hs01_00238456 predicted 484
4 SASI_Hs01_00238457 predicted 454
5 SASI_Hs01_00238458 predicted 502
6 SASI_Hs01_00238460 predicted 322
7 SASI_Hs01_00238461 predicted 691
8 SASI_Hs01_00238462 predicted 703
9 SASI_Hs01_00238463 predicted 664
10 SASI_Hs01_00238464 predicted 666
11 SASI_Hs01_00238455 predicted 697
12 SASI_Hs01_00238459 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013891 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053789 predicted 237
2 SASI_Rn01_00053790 predicted 618
3 SASI_Rn01_00053791 predicted 487
4 SASI_Rn01_00053793 predicted 359
5 SASI_Rn01_00053794 predicted 251
6 SASI_Rn02_00201170 predicted 893
7 SASI_Rn02_00201171 predicted 800
8 SASI_Rn01_00053796 predicted 289
9 SASI_Rn01_00053797 predicted 342
10 SASI_Rn02_00201172 predicted 395
11 SASI_Rn01_00053792 predicted 740
12 SASI_Rn01_00053795 predicted 758
13 SASI_Rn01_00053798 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175646 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130997 predicted 345
2 SASI_Mm01_00130990 predicted 826
3 SASI_Mm01_00130998 predicted 551
4 SASI_Mm01_00130999 predicted 568
5 SASI_Mm02_00346577 predicted 289
6 SASI_Mm01_00130992 predicted 914
7 SASI_Mm02_00346578 predicted 426
8 SASI_Mm02_00346579 predicted 378
9 SASI_Mm02_00346580 predicted 316
10 SASI_Mm01_00130994 predicted 781
11 SASI_Mm01_00130991 predicted 809
12 SASI_Mm01_00130993 predicted 865
13 SASI_Mm01_00130995 predicted 867
14 SASI_Mm01_00130996 predicted 871
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017853
VALIDATED
TXNL4B MISSION shRNA Bacterial Glycerol Stock
thioredoxin-like 4B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017853.2-448s21c1
Sequence:CCGGCTAAGACCTCTTCTGACTTAACTCGAGTTAAGTCAGAAGAGGTCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017853.2-1074s21c1
Sequence:CCGGTTGGCTAGTACAACTTGATTTCTCGAGAAATCAAGTTGTACTAGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017853.2-347s21c1
Sequence:CCGGGGAAGTAGACCAGGCGATAAACTCGAGTTTATCGCCTGGTCTACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017853.2-694s21c1
Sequence:CCGGTTATTGTCCAAAGTCCTATTGCTCGAGCAATAGGACTTTGGACAATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017853.1-692s1c1
Sequence:CCGGCCCAAGAATATTCCCAAATATCTCGAGATATTTGGGAATATTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017853.1-452s1c1
Sequence:CCGGGCTGCTATATACCTGGTGGATCTCGAGATCCACCAGGTATATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017853.1-713s1c1
Sequence:CCGGGACCTTCTCTATCAAGACATTCTCGAGAATGTCTTGATAGAGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017853.1-572s1c1
Sequence:CCGGTCTCCAGATCACACTAAGTTTCTCGAGAAACTTAGTGTGATCTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_017853.1-609s1c1
Sequence:CCGGCCAAACAAGACTTCATAGATTCTCGAGAATCTATGAAGTCTTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017853
VALIDATED
TXNL4B MISSION shRNA shRNA Plasmid DNA
thioredoxin-like 4B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017853.2-448s21c1
Sequence:CCGGCTAAGACCTCTTCTGACTTAACTCGAGTTAAGTCAGAAGAGGTCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017853.2-1074s21c1
Sequence:CCGGTTGGCTAGTACAACTTGATTTCTCGAGAAATCAAGTTGTACTAGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017853.2-347s21c1
Sequence:CCGGGGAAGTAGACCAGGCGATAAACTCGAGTTTATCGCCTGGTCTACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017853.2-694s21c1
Sequence:CCGGTTATTGTCCAAAGTCCTATTGCTCGAGCAATAGGACTTTGGACAATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017853.1-692s1c1
Sequence:CCGGCCCAAGAATATTCCCAAATATCTCGAGATATTTGGGAATATTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017853.1-452s1c1
Sequence:CCGGGCTGCTATATACCTGGTGGATCTCGAGATCCACCAGGTATATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017853.1-713s1c1
Sequence:CCGGGACCTTCTCTATCAAGACATTCTCGAGAATGTCTTGATAGAGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017853.1-572s1c1
Sequence:CCGGTCTCCAGATCACACTAAGTTTCTCGAGAAACTTAGTGTGATCTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_017853.1-609s1c1
Sequence:CCGGCCAAACAAGACTTCATAGATTCTCGAGAATCTATGAAGTCTTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017853
VALIDATED
TXNL4B MISSION shRNA Lentiviral Transduction Particles
thioredoxin-like 4B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017853.2-448s21c1
Sequence:CCGGCTAAGACCTCTTCTGACTTAACTCGAGTTAAGTCAGAAGAGGTCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017853.2-1074s21c1
Sequence:CCGGTTGGCTAGTACAACTTGATTTCTCGAGAAATCAAGTTGTACTAGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017853.2-347s21c1
Sequence:CCGGGGAAGTAGACCAGGCGATAAACTCGAGTTTATCGCCTGGTCTACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017853.2-694s21c1
Sequence:CCGGTTATTGTCCAAAGTCCTATTGCTCGAGCAATAGGACTTTGGACAATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017853.1-692s1c1
Sequence:CCGGCCCAAGAATATTCCCAAATATCTCGAGATATTTGGGAATATTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017853.1-452s1c1
Sequence:CCGGGCTGCTATATACCTGGTGGATCTCGAGATCCACCAGGTATATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017853.1-713s1c1
Sequence:CCGGGACCTTCTCTATCAAGACATTCTCGAGAATGTCTTGATAGAGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017853.1-572s1c1
Sequence:CCGGTCTCCAGATCACACTAAGTTTCTCGAGAAACTTAGTGTGATCTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_017853.1-609s1c1
Sequence:CCGGCCAAACAAGACTTCATAGATTCTCGAGAATCTATGAAGTCTTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175646
VALIDATED
TXNL4B MISSION shRNA Bacterial Glycerol Stock
thioredoxin-like 4B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175646.3-985s21c1
Sequence:CCGGGCTTATCTTGAACTAACTAATCTCGAGATTAGTTAGTTCAAGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175646.3-439s21c1
Sequence:CCGGGTCTCCGGATCACACTAAATTCTCGAGAATTTAGTGTGATCCGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175646.3-478s1c1
Sequence:CCGGCAAACAAGACTTCATAGATTTCTCGAGAAATCTATGAAGTCTTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175646.3-417s21c1
Sequence:CCGGAGCACATGAAGGTGGATTATGCTCGAGCATAATCCACCTTCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175646.3-560s21c1
Sequence:CCGGCCCAAGAACGTGCCCAAATATCTCGAGATATTTGGGCACGTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175646.3-383s21c1
Sequence:CCGGTACATTCCCTCTACCGTATTTCTCGAGAAATACGGTAGAGGGAATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175646.2-255s1c1
Sequence:CCGGGCTGGATGATATTCTCTCAAACTCGAGTTTGAGAGAATATCATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194641    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175646.2-1103s1c1
Sequence:CCGGGCACGGCTTAGCTTAACACAACTCGAGTTGTGTTAAGCTAAGCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193369    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175646.2-826s1c1
Sequence:CCGGCCGTTTATCTTGACTTTGCTTCTCGAGAAGCAAAGTCAAGATAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175646
VALIDATED
TXNL4B MISSION shRNA shRNA Plasmid DNA
thioredoxin-like 4B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175646.3-985s21c1
Sequence:CCGGGCTTATCTTGAACTAACTAATCTCGAGATTAGTTAGTTCAAGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175646.3-439s21c1
Sequence:CCGGGTCTCCGGATCACACTAAATTCTCGAGAATTTAGTGTGATCCGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175646.3-478s1c1
Sequence:CCGGCAAACAAGACTTCATAGATTTCTCGAGAAATCTATGAAGTCTTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175646.3-417s21c1
Sequence:CCGGAGCACATGAAGGTGGATTATGCTCGAGCATAATCCACCTTCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175646.3-560s21c1
Sequence:CCGGCCCAAGAACGTGCCCAAATATCTCGAGATATTTGGGCACGTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175646.3-383s21c1
Sequence:CCGGTACATTCCCTCTACCGTATTTCTCGAGAAATACGGTAGAGGGAATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175646.2-255s1c1
Sequence:CCGGGCTGGATGATATTCTCTCAAACTCGAGTTTGAGAGAATATCATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194641    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175646.2-1103s1c1
Sequence:CCGGGCACGGCTTAGCTTAACACAACTCGAGTTGTGTTAAGCTAAGCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193369    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175646.2-826s1c1
Sequence:CCGGCCGTTTATCTTGACTTTGCTTCTCGAGAAGCAAAGTCAAGATAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175646
VALIDATED
TXNL4B MISSION shRNA Lentiviral Transduction Particles
thioredoxin-like 4B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175646.3-985s21c1
Sequence:CCGGGCTTATCTTGAACTAACTAATCTCGAGATTAGTTAGTTCAAGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175646.3-439s21c1
Sequence:CCGGGTCTCCGGATCACACTAAATTCTCGAGAATTTAGTGTGATCCGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175646.3-478s1c1
Sequence:CCGGCAAACAAGACTTCATAGATTTCTCGAGAAATCTATGAAGTCTTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175646.3-417s21c1
Sequence:CCGGAGCACATGAAGGTGGATTATGCTCGAGCATAATCCACCTTCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175646.3-560s21c1
Sequence:CCGGCCCAAGAACGTGCCCAAATATCTCGAGATATTTGGGCACGTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175646.3-383s21c1
Sequence:CCGGTACATTCCCTCTACCGTATTTCTCGAGAAATACGGTAGAGGGAATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175646.2-255s1c1
Sequence:CCGGGCTGGATGATATTCTCTCAAACTCGAGTTTGAGAGAATATCATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194641    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175646.2-1103s1c1
Sequence:CCGGGCACGGCTTAGCTTAACACAACTCGAGTTGTGTTAAGCTAAGCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193369    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175646.2-826s1c1
Sequence:CCGGCCGTTTATCTTGACTTTGCTTCTCGAGAAGCAAAGTCAAGATAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks