EMAIL THIS PAGE TO A FRIEND

TXNRD1

thioredoxin reductase 1

Synonyms: GRIM-12 TR TR1 TRXR1 TXNR
Gene ID:
Human(7296) Summary: This gene encodes a member of the family of pyridine nucleotide oxidoreductases. This protein reduces thioredoxins as well as other substrates, and plays a role in selenium metabolism and protection against oxidative stress. The functional enzyme is thought to be a homodimer which uses FAD as a cofactor. Each subunit contains a selenocysteine (Sec) residue which is required for catalytic activity. The selenocysteine is encoded by the UGA codon that normally signals translation termination. The 3' UTR of selenocysteine-containing genes have a common stem-loop structure, the sec insertion sequence (SECIS), that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. Alternative splicing results in several transcript variants encoding the same or different isoforms. [provided by RefSeq, Jul 2008]
Mouse(50493) thioredoxin reductase 1
Rat(58819) thioredoxin reductase 1
Zebrafish(352924) thioredoxin reductase 1
Horse(100067923) thioredoxin reductase 1
chicken(418082) thioredoxin reductase 1
dog(474536) thioredoxin reductase 1
domestic cat(101085222) thioredoxin reductase 1
cow(282388) thioredoxin reductase 1
sheep(101112970) thioredoxin reductase 1
naked mole-rat(101700382) thioredoxin reductase 1
Domestic Rabbit(100356179) thioredoxin reductase 1
domestic guinea pig(100718723) thioredoxin reductase 1
193 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Activity Assay

Product # Description Species Add to Cart
 
CS0170 Thioredoxin Reductase Assay Kit  kit sufficient for 100 assays (1 mL) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182743 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182743 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182743 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015762 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015762 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015762 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001093771 Rosetta Predictions human pricing
NM_003330 Rosetta Predictions human pricing
NM_182729 Rosetta Predictions human pricing
NM_182742 Rosetta Predictions human pricing
NM_182743 Rosetta Predictions human pricing
NM_031614 Rosetta Predictions rat pricing
NM_001042513 Rosetta Predictions mouse pricing
NM_001042514 Rosetta Predictions mouse pricing
NM_001042523 Rosetta Predictions mouse pricing
NM_015762 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001093771 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318195 predicted 1212
2 SASI_Hs02_00318196 predicted 1100
3 SASI_Hs02_00318197 predicted 1816
4 SASI_Hs02_00318198 predicted 1115
5 SASI_Hs02_00318199 predicted 855
6 SASI_Hs02_00318200 predicted 1087
7 SASI_Hs02_00318201 predicted 1299
8 SASI_Hs02_00318202 predicted 931
9 SASI_Hs02_00318203 predicted 1466
10 SASI_Hs02_00318204 predicted 2027
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019902 predicted 1285
2 SASI_Hs01_00019903 predicted 1174
3 SASI_Hs01_00019905 predicted 1891
4 SASI_Hs01_00019906 predicted 1186
5 SASI_Hs01_00019907 predicted 924
6 SASI_Hs01_00019908 predicted 1151
7 SASI_Hs01_00019909 predicted 1371
8 SASI_Hs01_00019910 predicted 1000
9 SASI_Hs01_00019911 predicted 1540
10 SASI_Hs02_00335479 predicted 2093
11 SASI_Hs01_00019904 predicted 1911
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182729 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194473 predicted 1049
2 SASI_Hs01_00194474 predicted 936
3 SASI_Hs01_00194476 predicted 1651
4 SASI_Hs01_00194477 predicted 948
5 SASI_Hs01_00194478 predicted 690
6 SASI_Hs01_00194479 predicted 914
7 SASI_Hs01_00194480 predicted 1140
8 SASI_Hs01_00194481 predicted 762
9 SASI_Hs01_00194482 predicted 1302
10 SASI_Hs02_00370888 predicted 1860
11 SASI_Hs01_00194475 predicted 1676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182742 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035866 predicted 1181
2 SASI_Hs01_00035867 predicted 1058
3 SASI_Hs01_00035869 predicted 1778
4 SASI_Hs01_00035870 predicted 1083
5 SASI_Hs01_00035871 predicted 812
6 SASI_Hs01_00035872 predicted 1050
7 SASI_Hs01_00035873 predicted 1267
8 SASI_Hs01_00035874 predicted 889
9 SASI_Hs01_00035875 predicted 1423
10 SASI_Hs02_00370890 predicted 1989
11 SASI_Hs01_00035868 predicted 1795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182743 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174539 predicted 940
2 SASI_Hs01_00174540 predicted 825
3 SASI_Hs01_00174542 predicted 1546
4 SASI_Hs01_00174543 predicted 842
5 SASI_Hs01_00174544 predicted 572
6 SASI_Hs01_00174545 predicted 805
7 SASI_Hs01_00174546 predicted 1031
8 SASI_Hs01_00174547 predicted 655
9 SASI_Hs01_00174548 predicted 1190
10 SASI_Hs02_00370891 predicted 1748
11 SASI_Hs01_00174541 predicted 1564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031614 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112343 predicted 1066
2 SASI_Rn01_00112345 predicted 1169
3 SASI_Rn01_00112346 predicted 862
4 SASI_Rn01_00112347 predicted 1314
5 SASI_Rn01_00112348 predicted 1204
6 SASI_Rn01_00112349 predicted 450
7 SASI_Rn01_00112350 predicted 496
8 SASI_Rn01_00112351 predicted 257
9 SASI_Rn01_00112352 predicted 893
10 SASI_Rn02_00264906 predicted 492
11 SASI_Rn01_00112344 predicted 490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042513 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290505 predicted 471
2 SASI_Mm02_00290506 predicted 1662
3 SASI_Mm02_00290507 predicted 834
4 SASI_Mm02_00290508 predicted 1188
5 SASI_Mm02_00290509 predicted 1204
6 SASI_Mm02_00290510 predicted 656
7 SASI_Mm02_00290511 predicted 1064
8 SASI_Mm02_00290512 predicted 860
9 SASI_Mm02_00290513 predicted 1513
10 SASI_Mm02_00290514 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042514 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290515 predicted 560
2 SASI_Mm02_00290516 predicted 1749
3 SASI_Mm02_00290517 predicted 922
4 SASI_Mm02_00290518 predicted 1281
5 SASI_Mm02_00290519 predicted 1288
6 SASI_Mm02_00290520 predicted 745
7 SASI_Mm02_00290521 predicted 1150
8 SASI_Mm02_00290522 predicted 947
9 SASI_Mm02_00290523 predicted 1602
10 SASI_Mm02_00290524 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042523 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290525 predicted 682
2 SASI_Mm02_00290526 predicted 1873
3 SASI_Mm02_00290527 predicted 1058
4 SASI_Mm02_00290528 predicted 1410
5 SASI_Mm02_00290529 predicted 1418
6 SASI_Mm02_00290530 predicted 874
7 SASI_Mm02_00290531 predicted 1288
8 SASI_Mm02_00290532 predicted 1079
9 SASI_Mm02_00290533 predicted 869
10 SASI_Mm02_00290534 predicted 1733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015762 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062875 predicted 364
2 SASI_Mm01_00062876 predicted 1553
3 SASI_Mm01_00062877 predicted 733
4 SASI_Mm01_00062878 predicted 1081
5 SASI_Mm01_00062879 predicted 1100
6 SASI_Mm01_00062881 predicted 550
7 SASI_Mm01_00062882 predicted 959
8 SASI_Mm01_00062883 predicted 752
9 SASI_Mm01_00062884 predicted 1414
10 SASI_Mm02_00323093 predicted 377
11 SASI_Mm01_00062880 predicted 826
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182743
VALIDATED
TXNRD1 MISSION shRNA Bacterial Glycerol Stock
thioredoxin reductase 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_182743.1-813s1c1
Sequence:CCGGGCTGGATTTCTTGCTGGTATTCTCGAGAATACCAGCAAGAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_182743.1-609s1c1
Sequence:CCGGCACAGGATTAAGGCAACAAATCTCGAGATTTGTTGCCTTAATCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_182743.1-1315s1c1
Sequence:CCGGCTGTATTTACTCCTTTGGAATCTCGAGATTCCAAAGGAGTAAATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_182743.1-434s1c1
Sequence:CCGGCCTGCAAGACTCTCGAAATTACTCGAGTAATTTCGAGAGTCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_182743.1-1438s1c1
Sequence:CCGGCGTCAAGAGATAACAACAAATCTCGAGATTTGTTGTTATCTCTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182743
VALIDATED
TXNRD1 MISSION shRNA shRNA Plasmid DNA
thioredoxin reductase 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_182743.1-813s1c1
Sequence:CCGGGCTGGATTTCTTGCTGGTATTCTCGAGAATACCAGCAAGAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_182743.1-609s1c1
Sequence:CCGGCACAGGATTAAGGCAACAAATCTCGAGATTTGTTGCCTTAATCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_182743.1-1315s1c1
Sequence:CCGGCTGTATTTACTCCTTTGGAATCTCGAGATTCCAAAGGAGTAAATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_182743.1-434s1c1
Sequence:CCGGCCTGCAAGACTCTCGAAATTACTCGAGTAATTTCGAGAGTCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_182743.1-1438s1c1
Sequence:CCGGCGTCAAGAGATAACAACAAATCTCGAGATTTGTTGTTATCTCTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182743
VALIDATED
TXNRD1 MISSION shRNA Lentiviral Transduction Particles
thioredoxin reductase 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_182743.1-813s1c1
Sequence:CCGGGCTGGATTTCTTGCTGGTATTCTCGAGAATACCAGCAAGAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_182743.1-609s1c1
Sequence:CCGGCACAGGATTAAGGCAACAAATCTCGAGATTTGTTGCCTTAATCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_182743.1-1315s1c1
Sequence:CCGGCTGTATTTACTCCTTTGGAATCTCGAGATTCCAAAGGAGTAAATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_182743.1-434s1c1
Sequence:CCGGCCTGCAAGACTCTCGAAATTACTCGAGTAATTTCGAGAGTCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_182743.1-1438s1c1
Sequence:CCGGCGTCAAGAGATAACAACAAATCTCGAGATTTGTTGTTATCTCTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015762
VALIDATED
TXNRD1 MISSION shRNA Bacterial Glycerol Stock
thioredoxin reductase 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000042349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015762.1-249s1c1
Sequence:CCGGGCAGCCAAATTTGACAAGAAACTCGAGTTTCTTGTCAAATTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015762.1-1027s1c1
Sequence:CCGGCGGTAGGAAGAGATTCTTGTACTCGAGTACAAGAATCTCTTCCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015762.1-1404s1c1
Sequence:CCGGCGGGATAACAACAAATGTTATCTCGAGATAACATTTGTTGTTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015762.1-1124s1c1
Sequence:CCGGGCAGACCAATGTGCCTTACATCTCGAGATGTAAGGCACATTGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015762
VALIDATED
TXNRD1 MISSION shRNA shRNA Plasmid DNA
thioredoxin reductase 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000042349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015762.1-249s1c1
Sequence:CCGGGCAGCCAAATTTGACAAGAAACTCGAGTTTCTTGTCAAATTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015762.1-1027s1c1
Sequence:CCGGCGGTAGGAAGAGATTCTTGTACTCGAGTACAAGAATCTCTTCCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015762.1-1404s1c1
Sequence:CCGGCGGGATAACAACAAATGTTATCTCGAGATAACATTTGTTGTTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015762.1-1124s1c1
Sequence:CCGGGCAGACCAATGTGCCTTACATCTCGAGATGTAAGGCACATTGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015762
VALIDATED
TXNRD1 MISSION shRNA Lentiviral Transduction Particles
thioredoxin reductase 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000042349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015762.1-249s1c1
Sequence:CCGGGCAGCCAAATTTGACAAGAAACTCGAGTTTCTTGTCAAATTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015762.1-1027s1c1
Sequence:CCGGCGGTAGGAAGAGATTCTTGTACTCGAGTACAAGAATCTCTTCCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015762.1-1404s1c1
Sequence:CCGGCGGGATAACAACAAATGTTATCTCGAGATAACATTTGTTGTTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015762.1-1124s1c1
Sequence:CCGGGCAGACCAATGTGCCTTACATCTCGAGATGTAAGGCACATTGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks