EMAIL THIS PAGE TO A FRIEND

TXNRD2

thioredoxin reductase 2

Synonyms: SELZ TR TR-BETA TR3 TRXR2
Gene ID:
Human(10587) Summary: Thioredoxin reductase (TR) is a dimeric NADPH-dependent FAD containing enzyme that catalyzes the reduction of the active site disulfide of thioredoxin and other substrates. TR is a member of a family of pyridine nucleotide-disulfide oxidoreductases and is a key enzyme in the regulation of the intracellular redox environment. Three thioredoxin reductase genes have been found that encode selenocysteine containing proteins. This gene partially overlaps the COMT gene on chromosome 22. [provided by RefSeq, Jul 2008]
Mouse(26462) thioredoxin reductase 2
Rat(50551) thioredoxin reductase 2
domestic guinea pig(100729960) thioredoxin reductase 2
Domestic Rabbit(100354391) thioredoxin reductase 2
naked mole-rat(101718079) thioredoxin reductase 2
cow(282389) thioredoxin reductase 2
chicken(416782) thioredoxin reductase 2
Horse(100051917) thioredoxin reductase 2
domestic cat(101101420) thioredoxin reductase 2
dog(608155) thioredoxin reductase 2
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Activity Assay

Product # Description Species Add to Cart
 
CS0170 Thioredoxin Reductase Assay Kit  kit sufficient for 100 assays (1 mL) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006440 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006440 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006440 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013711 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013711 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013711 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006440 Rosetta Predictions human pricing
NM_022584 Rosetta Predictions rat pricing
NM_013711 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105724 predicted 614
2 SASI_Hs01_00105725 predicted 1346
3 SASI_Hs01_00105726 predicted 1305
4 SASI_Hs01_00105727 predicted 1190
5 SASI_Hs01_00105728 predicted 1292
6 SASI_Hs01_00105729 predicted 1172
7 SASI_Hs01_00105730 predicted 985
8 SASI_Hs02_00341575 predicted 1436
9 SASI_Hs01_00105731 predicted 1478
10 SASI_Hs01_00105732 predicted 1315
11 SASI_Hs01_00105733 predicted 743
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022584 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086042 predicted 1463
2 SASI_Rn01_00086044 predicted 1430
3 SASI_Rn01_00086045 predicted 1159
4 SASI_Rn01_00086046 predicted 1204
5 SASI_Rn01_00086047 predicted 1216
6 SASI_Rn01_00086048 predicted 499
7 SASI_Rn01_00086049 predicted 1117
8 SASI_Rn01_00086050 predicted 454
9 SASI_Rn01_00086051 predicted 1327
10 SASI_Rn02_00263325 predicted 414
11 SASI_Rn01_00086043 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013711 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046346 predicted 1211
2 SASI_Mm01_00046347 predicted 639
3 SASI_Mm01_00046348 predicted 811
4 SASI_Mm01_00046349 predicted 1484
5 SASI_Mm01_00046350 predicted 1231
6 SASI_Mm01_00046351 predicted 1312
7 SASI_Mm01_00046352 predicted 565
8 SASI_Mm01_00046353 predicted 357
9 SASI_Mm01_00046355 predicted 1356
10 SASI_Mm02_00322622 predicted 1181
11 SASI_Mm01_00046354 predicted 484
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006440
TXNRD2 MISSION shRNA Bacterial Glycerol Stock
thioredoxin reductase 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006440.2-1476s1c1
Sequence:CCGGCCATTATAAACCACTGGAGTTCTCGAGAACTCCAGTGGTTTATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006440.2-796s1c1
Sequence:CCGGGAATATGGAATCACAAGTGATCTCGAGATCACTTGTGATTCCATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006440.2-651s1c1
Sequence:CCGGCTTTAACATCAAAGCCAGCTTCTCGAGAAGCTGGCTTTGATGTTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006440.2-727s1c1
Sequence:CCGGTCAGCCGATCACATCATCATTCTCGAGAATGATGATGTGATCGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006440.2-1354s1c1
Sequence:CCGGCTGATGGACTACGACAATGTTCTCGAGAACATTGTCGTAGTCCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006440.3-826s21c1
Sequence:CCGGATAGAGCACATGGCATCTCATCTCGAGATGAGATGCCATGTGCTCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006440.3-1132s21c1
Sequence:CCGGCTGACACCCATAGCGATCATGCTCGAGCATGATCGCTATGGGTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006440
TXNRD2 MISSION shRNA shRNA Plasmid DNA
thioredoxin reductase 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006440.2-1476s1c1
Sequence:CCGGCCATTATAAACCACTGGAGTTCTCGAGAACTCCAGTGGTTTATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006440.2-796s1c1
Sequence:CCGGGAATATGGAATCACAAGTGATCTCGAGATCACTTGTGATTCCATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006440.2-651s1c1
Sequence:CCGGCTTTAACATCAAAGCCAGCTTCTCGAGAAGCTGGCTTTGATGTTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006440.2-727s1c1
Sequence:CCGGTCAGCCGATCACATCATCATTCTCGAGAATGATGATGTGATCGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006440.2-1354s1c1
Sequence:CCGGCTGATGGACTACGACAATGTTCTCGAGAACATTGTCGTAGTCCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006440.3-826s21c1
Sequence:CCGGATAGAGCACATGGCATCTCATCTCGAGATGAGATGCCATGTGCTCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006440.3-1132s21c1
Sequence:CCGGCTGACACCCATAGCGATCATGCTCGAGCATGATCGCTATGGGTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006440
TXNRD2 MISSION shRNA Lentiviral Transduction Particles
thioredoxin reductase 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006440.2-1476s1c1
Sequence:CCGGCCATTATAAACCACTGGAGTTCTCGAGAACTCCAGTGGTTTATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006440.2-796s1c1
Sequence:CCGGGAATATGGAATCACAAGTGATCTCGAGATCACTTGTGATTCCATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006440.2-651s1c1
Sequence:CCGGCTTTAACATCAAAGCCAGCTTCTCGAGAAGCTGGCTTTGATGTTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006440.2-727s1c1
Sequence:CCGGTCAGCCGATCACATCATCATTCTCGAGAATGATGATGTGATCGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006440.2-1354s1c1
Sequence:CCGGCTGATGGACTACGACAATGTTCTCGAGAACATTGTCGTAGTCCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006440.3-826s21c1
Sequence:CCGGATAGAGCACATGGCATCTCATCTCGAGATGAGATGCCATGTGCTCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006440.3-1132s21c1
Sequence:CCGGCTGACACCCATAGCGATCATGCTCGAGCATGATCGCTATGGGTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013711
VALIDATED
TXNRD2 MISSION shRNA Bacterial Glycerol Stock
thioredoxin reductase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013711.1-1462s1c1
Sequence:CCGGCCAAGGATTTGCTCTTGGGATCTCGAGATCCCAAGAGCAAATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013711.1-403s1c1
Sequence:CCGGCCAACACAACTGGAAGACAATCTCGAGATTGTCTTCCAGTTGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013711.1-1373s1c1
Sequence:CCGGCAGTGCTACATAAAGATGGTACTCGAGTACCATCTTTATGTAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013711.1-148s1c1
Sequence:CCGGGCAGCAGAGCTTTGATCTCTTCTCGAGAAGAGATCAAAGCTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013711.1-642s1c1
Sequence:CCGGCCCTGGAATATGGAATCACAACTCGAGTTGTGATTCCATATTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013711
VALIDATED
TXNRD2 MISSION shRNA shRNA Plasmid DNA
thioredoxin reductase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013711.1-1462s1c1
Sequence:CCGGCCAAGGATTTGCTCTTGGGATCTCGAGATCCCAAGAGCAAATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013711.1-403s1c1
Sequence:CCGGCCAACACAACTGGAAGACAATCTCGAGATTGTCTTCCAGTTGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013711.1-1373s1c1
Sequence:CCGGCAGTGCTACATAAAGATGGTACTCGAGTACCATCTTTATGTAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013711.1-148s1c1
Sequence:CCGGGCAGCAGAGCTTTGATCTCTTCTCGAGAAGAGATCAAAGCTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013711.1-642s1c1
Sequence:CCGGCCCTGGAATATGGAATCACAACTCGAGTTGTGATTCCATATTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013711
VALIDATED
TXNRD2 MISSION shRNA Lentiviral Transduction Particles
thioredoxin reductase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013711.1-1462s1c1
Sequence:CCGGCCAAGGATTTGCTCTTGGGATCTCGAGATCCCAAGAGCAAATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013711.1-403s1c1
Sequence:CCGGCCAACACAACTGGAAGACAATCTCGAGATTGTCTTCCAGTTGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013711.1-1373s1c1
Sequence:CCGGCAGTGCTACATAAAGATGGTACTCGAGTACCATCTTTATGTAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013711.1-148s1c1
Sequence:CCGGGCAGCAGAGCTTTGATCTCTTCTCGAGAAGAGATCAAAGCTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013711.1-642s1c1
Sequence:CCGGCCCTGGAATATGGAATCACAACTCGAGTTGTGATTCCATATTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks