EMAIL THIS PAGE TO A FRIEND

TXNRD3

thioredoxin reductase 3

Synonyms: TGR TR2 TRXR3
UniProtKB ID: Q86VQ6, Q6PIS8, Q9NNW6, Q9P101
Gene ID:
Human(114112) Summary: This gene encodes a member of the family of pyridine nucleotide oxidoreductases. This protein catalyzes the reduction of thioredoxin, and is implicated in the defense against oxidative stress. It contains a selenocysteine (Sec) residue (which is essential for catalytic activity), encoded by a UGA codon, at the penultimate C-terminal position. The 3' UTR of Sec-containing genes have a common stem-loop structure, the sec insertion sequence (SECIS), which is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Mouse(232223) thioredoxin reductase 3
Rat(297437) thioredoxin reductase 3
Zebrafish(352925) thioredoxin reductase 3
Horse(100060514) thioredoxin reductase 3
domestic cat(101090928) thioredoxin reductase 3
dog(484619) thioredoxin reductase 3
chicken(416031) thioredoxin reductase 3
cow(319097) thioredoxin reductase 3
sheep(101117116) thioredoxin reductase 3
Domestic Rabbit(100358257) thioredoxin reductase 3
domestic guinea pig(100719286) thioredoxin reductase 3
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Activity Assay

Product # Description Species Add to Cart
 
CS0170 Thioredoxin Reductase Assay Kit  kit sufficient for 100 assays (1 mL) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153162 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153162 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153162 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_001129642 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001129642 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001129642 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_051264 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_051264 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_051264 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU067291 MISSION® esiRNA esiRNA targeting mouse Txnrd3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001129642 Rosetta Predictions human pricing
XM_001130163 Rosetta Predictions human pricing
NM_153162 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001129642 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00386392 predicted 994
2 SASI_Hs02_00386393 predicted 2007
3 SASI_Hs02_00386394 predicted 1592
4 SASI_Hs02_00386395 predicted 1411
5 SASI_Hs02_00386396 predicted 2346
6 SASI_Hs02_00386397 predicted 1734
7 SASI_Hs02_00386398 predicted 2127
8 SASI_Hs02_00386399 predicted 1734
9 SASI_Hs02_00386400 predicted 777
10 SASI_Hs02_00386401 predicted 1274
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001130163 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00387011 predicted 1000
2 SASI_Hs02_00387012 predicted 1596
3 SASI_Hs02_00387013 predicted 1413
4 SASI_Hs02_00387014 predicted 2338
5 SASI_Hs02_00387015 predicted 1736
6 SASI_Hs02_00387016 predicted 2125
7 SASI_Hs02_00387017 predicted 2010
8 SASI_Hs02_00387018 predicted 1729
9 SASI_Hs02_00387019 predicted 774
10 SASI_Hs02_00387020 predicted 1272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153162 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190835 predicted 1307
2 SASI_Mm01_00190836 predicted 1432
3 SASI_Mm01_00190837 predicted 705
4 SASI_Mm02_00343060 predicted 2028
5 SASI_Mm02_00343061 predicted 1892
6 SASI_Mm01_00190839 predicted 1853
7 SASI_Mm01_00190840 predicted 1845
8 SASI_Mm02_00343062 predicted 2035
9 SASI_Mm01_00190841 predicted 1598
10 SASI_Mm01_00190842 predicted 855
11 SASI_Mm01_00190838 predicted 1951
12 SASI_Mm01_00190843 predicted 997
13 SASI_Mm01_00190844 predicted 2135
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153162
VALIDATED
TXNRD3 MISSION shRNA Bacterial Glycerol Stock
thioredoxin reductase 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153162.3-563s21c1
Sequence:CCGGGGTGGATGTGACCGAACTTTCCTCGAGGAAAGTTCGGTCACATCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153162.3-2541s21c1
Sequence:CCGGGCACTGGCCTCCCACTAATATCTCGAGATATTAGTGGGAGGCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153162.2-778s1c1
Sequence:CCGGCGTAGGCTGTATTCCAAAGAACTCGAGTTCTTTGGAATACAGCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153162.2-1425s1c1
Sequence:CCGGCGGAAACAGTAGAAGGGATATCTCGAGATATCCCTTCTACTGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153162.2-1862s1c1
Sequence:CCGGGCAAAGATAATCTGCAACAAACTCGAGTTTGTTGCAGATTATCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153162.2-1752s1c1
Sequence:CCGGCGGAAGAGAAAGCCATCGAAACTCGAGTTTCGATGGCTTTCTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153162.2-2406s1c1
Sequence:CCGGCCCTCACTTTGTTTCCATGAACTCGAGTTCATGGAAACAAAGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153162
VALIDATED
TXNRD3 MISSION shRNA shRNA Plasmid DNA
thioredoxin reductase 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153162.3-563s21c1
Sequence:CCGGGGTGGATGTGACCGAACTTTCCTCGAGGAAAGTTCGGTCACATCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153162.3-2541s21c1
Sequence:CCGGGCACTGGCCTCCCACTAATATCTCGAGATATTAGTGGGAGGCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153162.2-778s1c1
Sequence:CCGGCGTAGGCTGTATTCCAAAGAACTCGAGTTCTTTGGAATACAGCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153162.2-1425s1c1
Sequence:CCGGCGGAAACAGTAGAAGGGATATCTCGAGATATCCCTTCTACTGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153162.2-1862s1c1
Sequence:CCGGGCAAAGATAATCTGCAACAAACTCGAGTTTGTTGCAGATTATCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153162.2-1752s1c1
Sequence:CCGGCGGAAGAGAAAGCCATCGAAACTCGAGTTTCGATGGCTTTCTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153162.2-2406s1c1
Sequence:CCGGCCCTCACTTTGTTTCCATGAACTCGAGTTCATGGAAACAAAGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153162
VALIDATED
TXNRD3 MISSION shRNA Lentiviral Transduction Particles
thioredoxin reductase 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153162.3-563s21c1
Sequence:CCGGGGTGGATGTGACCGAACTTTCCTCGAGGAAAGTTCGGTCACATCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153162.3-2541s21c1
Sequence:CCGGGCACTGGCCTCCCACTAATATCTCGAGATATTAGTGGGAGGCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153162.2-778s1c1
Sequence:CCGGCGTAGGCTGTATTCCAAAGAACTCGAGTTCTTTGGAATACAGCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153162.2-1425s1c1
Sequence:CCGGCGGAAACAGTAGAAGGGATATCTCGAGATATCCCTTCTACTGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153162.2-1862s1c1
Sequence:CCGGGCAAAGATAATCTGCAACAAACTCGAGTTTGTTGCAGATTATCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153162.2-1752s1c1
Sequence:CCGGCGGAAGAGAAAGCCATCGAAACTCGAGTTTCGATGGCTTTCTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153162.2-2406s1c1
Sequence:CCGGCCCTCACTTTGTTTCCATGAACTCGAGTTCATGGAAACAAAGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001129642
VALIDATED
TXNRD3 MISSION shRNA Bacterial Glycerol Stock
thioredoxin reductase 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001129642.1-2896s21c2
Sequence:GTACCGGGGTGATAACCTTGAAGCTATTCTCGAGAATAGCTTCAAGGTTATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:XM_001129642.1-1750s21c2
Sequence:GTACCGGGTCTATGCTGTTGGTGATATTCTCGAGAATATCACCAACAGCATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:XM_001129642.1-1600s21c2
Sequence:CCGGACAATTGAAGGAGTCTATAACCTCGAGGTTATAGACTCCTTCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:XM_001129642.1-1562s21c2
Sequence:CCGGAGCTGAAAGTGTTGGCTAAATCTCGAGATTTAGCCAACACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:XM_001129642.1-1497s21c2
Sequence:CCGGTGTGAAGTTCCTACGGAAATTCTCGAGAATTTCCGTAGGAACTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001129642
VALIDATED
TXNRD3 MISSION shRNA shRNA Plasmid DNA
thioredoxin reductase 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001129642.1-2896s21c2
Sequence:GTACCGGGGTGATAACCTTGAAGCTATTCTCGAGAATAGCTTCAAGGTTATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:XM_001129642.1-1750s21c2
Sequence:GTACCGGGTCTATGCTGTTGGTGATATTCTCGAGAATATCACCAACAGCATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:XM_001129642.1-1600s21c2
Sequence:CCGGACAATTGAAGGAGTCTATAACCTCGAGGTTATAGACTCCTTCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:XM_001129642.1-1562s21c2
Sequence:CCGGAGCTGAAAGTGTTGGCTAAATCTCGAGATTTAGCCAACACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:XM_001129642.1-1497s21c2
Sequence:CCGGTGTGAAGTTCCTACGGAAATTCTCGAGAATTTCCGTAGGAACTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001129642
VALIDATED
TXNRD3 MISSION shRNA Lentiviral Transduction Particles
thioredoxin reductase 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001129642.1-2896s21c2
Sequence:GTACCGGGGTGATAACCTTGAAGCTATTCTCGAGAATAGCTTCAAGGTTATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:XM_001129642.1-1750s21c2
Sequence:GTACCGGGTCTATGCTGTTGGTGATATTCTCGAGAATATCACCAACAGCATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:XM_001129642.1-1600s21c2
Sequence:CCGGACAATTGAAGGAGTCTATAACCTCGAGGTTATAGACTCCTTCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:XM_001129642.1-1562s21c2
Sequence:CCGGAGCTGAAAGTGTTGGCTAAATCTCGAGATTTAGCCAACACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:XM_001129642.1-1497s21c2
Sequence:CCGGTGTGAAGTTCCTACGGAAATTCTCGAGAATTTCCGTAGGAACTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_051264
VALIDATED
TXNRD3 MISSION shRNA Bacterial Glycerol Stock
thioredoxin reductase 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051264.11-1321s1c1
Sequence:CCGGCCACGGTATTTAGGAATCCAACTCGAGTTGGATTCCTAAATACCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051264.11-998s1c1
Sequence:CCGGGCACTTGTGTAAATGTAGGTTCTCGAGAACCTACATTTACACAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_051264.11-729s1c1
Sequence:CCGGGTCAGAAATCACTAATCAGAACTCGAGTTCTGATTAGTGATTTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051264.11-2035s1c1
Sequence:CCGGCATACTTTGTTCTGGCCTCTTCTCGAGAAGAGGCCAGAACAAAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051264.11-142s1c1
Sequence:CCGGCCCAATCAGAACGGACTGAATCTCGAGATTCAGTCCGTTCTGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_051264
VALIDATED
TXNRD3 MISSION shRNA shRNA Plasmid DNA
thioredoxin reductase 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051264.11-1321s1c1
Sequence:CCGGCCACGGTATTTAGGAATCCAACTCGAGTTGGATTCCTAAATACCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051264.11-998s1c1
Sequence:CCGGGCACTTGTGTAAATGTAGGTTCTCGAGAACCTACATTTACACAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_051264.11-729s1c1
Sequence:CCGGGTCAGAAATCACTAATCAGAACTCGAGTTCTGATTAGTGATTTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051264.11-2035s1c1
Sequence:CCGGCATACTTTGTTCTGGCCTCTTCTCGAGAAGAGGCCAGAACAAAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051264.11-142s1c1
Sequence:CCGGCCCAATCAGAACGGACTGAATCTCGAGATTCAGTCCGTTCTGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_051264
VALIDATED
TXNRD3 MISSION shRNA Lentiviral Transduction Particles
thioredoxin reductase 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051264.11-1321s1c1
Sequence:CCGGCCACGGTATTTAGGAATCCAACTCGAGTTGGATTCCTAAATACCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051264.11-998s1c1
Sequence:CCGGGCACTTGTGTAAATGTAGGTTCTCGAGAACCTACATTTACACAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_051264.11-729s1c1
Sequence:CCGGGTCAGAAATCACTAATCAGAACTCGAGTTCTGATTAGTGATTTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051264.11-2035s1c1
Sequence:CCGGCATACTTTGTTCTGGCCTCTTCTCGAGAAGAGGCCAGAACAAAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051264.11-142s1c1
Sequence:CCGGCCCAATCAGAACGGACTGAATCTCGAGATTCAGTCCGTTCTGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks