EMAIL THIS PAGE TO A FRIEND

TXNRD3NB

thioredoxin reductase 3 neighbor

Synonyms: TR2IT1 TXNRD3IT1 TXNRD3NT1
Species: Human TXNRD3NB(645840)
UniProtKB ID: Q6F5E7
Gene ID:
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039783 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039783 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039783 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU105381 MISSION® esiRNA esiRNA human TXNRD3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039783 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039783 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184233 predicted 905
2 SASI_Hs01_00184234 predicted 783
3 SASI_Hs01_00184235 predicted 869
4 SASI_Hs01_00184237 predicted 891
5 SASI_Hs01_00184238 predicted 843
6 SASI_Hs01_00184239 predicted 697
7 SASI_Hs01_00184240 predicted 816
8 SASI_Hs01_00184241 predicted 899
9 SASI_Hs01_00184236 predicted 830
10 SASI_Hs02_00308673 predicted 793
11 SASI_Hs01_00184242 predicted 609
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039783
TXNRD3NB MISSION shRNA Bacterial Glycerol Stock
thioredoxin reductase 3 neighbor
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039783.1-863s21c1
Sequence:CCGGGAAATGTATCAGCGGATGATCCTCGAGGATCATCCGCTGATACATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039783.1-699s21c1
Sequence:CCGGGCACTGCAAGCCAGATCTGTACTCGAGTACAGATCTGGCTTGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039783.1-912s21c1
Sequence:CCGGCACCCAATGGCTTAGCAATAACTCGAGTTATTGCTAAGCCATTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039783.1-833s21c1
Sequence:CCGGCATGAGAAAGGATGATGTTTGCTCGAGCAAACATCATCCTTTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039783.1-619s21c1
Sequence:CCGGTGGAACATGGAGACAAGGTTTCTCGAGAAACCTTGTCTCCATGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039783
TXNRD3NB MISSION shRNA shRNA Plasmid DNA
thioredoxin reductase 3 neighbor
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039783.1-863s21c1
Sequence:CCGGGAAATGTATCAGCGGATGATCCTCGAGGATCATCCGCTGATACATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039783.1-699s21c1
Sequence:CCGGGCACTGCAAGCCAGATCTGTACTCGAGTACAGATCTGGCTTGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039783.1-912s21c1
Sequence:CCGGCACCCAATGGCTTAGCAATAACTCGAGTTATTGCTAAGCCATTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039783.1-833s21c1
Sequence:CCGGCATGAGAAAGGATGATGTTTGCTCGAGCAAACATCATCCTTTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039783.1-619s21c1
Sequence:CCGGTGGAACATGGAGACAAGGTTTCTCGAGAAACCTTGTCTCCATGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039783
TXNRD3NB MISSION shRNA Lentiviral Transduction Particles
thioredoxin reductase 3 neighbor
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039783.1-863s21c1
Sequence:CCGGGAAATGTATCAGCGGATGATCCTCGAGGATCATCCGCTGATACATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039783.1-699s21c1
Sequence:CCGGGCACTGCAAGCCAGATCTGTACTCGAGTACAGATCTGGCTTGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039783.1-912s21c1
Sequence:CCGGCACCCAATGGCTTAGCAATAACTCGAGTTATTGCTAAGCCATTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039783.1-833s21c1
Sequence:CCGGCATGAGAAAGGATGATGTTTGCTCGAGCAAACATCATCCTTTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039783.1-619s21c1
Sequence:CCGGTGGAACATGGAGACAAGGTTTCTCGAGAAACCTTGTCTCCATGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks