EMAIL THIS PAGE TO A FRIEND

TYK2

tyrosine kinase 2

Synonyms: JTK1
UniProtKB ID: P29597, Q6QB10, Q96CH0
Gene ID:
Human(7297) Summary: This gene encodes a member of the tyrosine kinase and, more specifically, the Janus kinases (JAKs) protein families. This protein associates with the cytoplasmic domain of type I and type II cytokine receptors and promulgate cytokine signals by phosphorylating receptor subunits. It is also component of both the type I and type III interferon signaling pathways. As such, it may play a role in anti-viral immunity. A mutation in this gene has been associated with hyperimmunoglobulin E syndrome (HIES) - a primary immunodeficiency characterized by elevated serum immunoglobulin E. [provided by RefSeq, Jul 2008]
Mouse(54721) tyrosine kinase 2
Rat(100361294) tyrosine kinase 2
Zebrafish(100536675) tyrosine kinase 2
chicken(430113) tyrosine kinase 2
dog(476714) tyrosine kinase 2
domestic cat(101090171) tyrosine kinase 2
cow(512484) tyrosine kinase 2
sheep(101117248) tyrosine kinase 2
domestic guinea pig(100715734) tyrosine kinase 2
naked mole-rat(101715782) tyrosine kinase 2
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302430 ANTI-MOUSE TYK2 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB4300122 Anti-phospho-TYK2 (pTyr1054) antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
T0442 Anti-phospho-Tyk2 (pTyr1054/1055) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human
western blot pricing
T9077 Anti-TYK2 (1046-1060) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
T9202 Anti-TYK2 (106-120) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4300392 Anti-TYK2 (Ab-1054) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry pricing
SAB1411977 ANTI-TYK2 antibody produced in mouse clone 5A4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA005157 Anti-TYK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4503050 Anti-TYK2, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
WH0007297M1 Monoclonal Anti-TYK2 antibody produced in mouse clone 6G12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404502 Monoclonal Anti-TYK2 antibody produced in mouse clone 6H1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB5300360 Monoclonal Anti-TYK2 antibody produced in mouse clone 8G8E9, ascites fluid human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003331 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003331 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003331 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018793 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018793 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018793 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU148441 MISSION® esiRNA esiRNA targeting mouse Tyk2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003331 Rosetta Predictions human pricing
NM_018793 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003331 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107854 predicted 671
2 SASI_Hs01_00107855 predicted 659
3 SASI_Hs01_00107856 predicted 2043
4 SASI_Hs01_00107857 predicted 3608
5 SASI_Hs01_00107858 predicted 3071
6 SASI_Hs01_00107859 predicted 2038
7 SASI_Hs01_00107860 predicted 1137
8 SASI_Hs01_00107861 predicted 631
9 SASI_Hs01_00107862 predicted 847
10 SASI_Hs02_00335480 predicted 565
11 SASI_Hs01_00107853 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018793 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157555 predicted 3118
2 SASI_Mm02_00324104 predicted 2068
3 SASI_Mm01_00157558 predicted 808
4 SASI_Mm02_00324105 predicted 2314
5 SASI_Mm02_00324106 predicted 2304
6 SASI_Mm02_00324107 predicted 2074
7 SASI_Mm02_00324108 predicted 1720
8 SASI_Mm01_00157560 predicted 3014
9 SASI_Mm01_00157561 predicted 1032
10 SASI_Mm02_00324109 predicted 2995
11 SASI_Mm01_00157554 predicted 2895
12 SASI_Mm01_00157556 predicted 423
13 SASI_Mm01_00157557 predicted 2383
14 SASI_Mm01_00157559 predicted 3150
15 SASI_Mm01_00157562 predicted 863
16 SASI_Mm01_00157563 predicted 3457
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003331
VALIDATED
TYK2 MISSION shRNA Bacterial Glycerol Stock
tyrosine kinase 2
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003331.4-2171s21c1
Sequence:GTACCGGGCACAAGGACCAACGTGTATGCTCGAGCATACACGTTGGTCCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003331.4-1134s21c1
Sequence:GTACCGGGCAGATGGTCATGGTCAAATACTCGAGTATTTGACCATGACCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003331.4-4115s21c1
Sequence:CCGGCGTGAGCCTAACCATGATCTTCTCGAGAAGATCATGGTTAGGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003331.4-3246s21c1
Sequence:CCGGCGAGCACATCATCAAGTACAACTCGAGTTGTACTTGATGATGTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003331.4-3589s21c1
Sequence:CCGGGAGTGCCTGAAGGAGTATAAGCTCGAGCTTATACTCCTTCAGGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003331.4-901s21c1
Sequence:CCGGGAGATCCACCACTTTAAGAATCTCGAGATTCTTAAAGTGGTGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003331.4-666s21c1
Sequence:CCGGTGCAAGCCTGATGCTATATTTCTCGAGAAATATAGCATCAGGCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003331.x-864s1c1
Sequence:CCGGGAGATCCACCACTTTAAGAATCTCGAGATTCTTAAAGTGGTGGATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003331.x-2906s1c1
Sequence:CCGGGAGGCCATCATTCCGCACCATCTCGAGATGGTGCGGAATGATGGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003331.x-3209s1c1
Sequence:CCGGCGAGCACATCATCAAGTACAACTCGAGTTGTACTTGATGATGTGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003331.x-4078s1c1
Sequence:CCGGCGTGAGCCTAACCATGATCTTCTCGAGAAGATCATGGTTAGGCTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003331.x-533s1c1
Sequence:CCGGTGGTATCACTCCTCCTTGCTTCTCGAGAAGCAAGGAGGAGTGATACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199470    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003331.3-3999s1c1
Sequence:CCGGGATGTCAGCCTCACCCACACCCTCGAGGGTGTGGGTGAGGCTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003331.3-638s1c1
Sequence:CCGGGATGCTATATTTCCGCATAAGCTCGAGCTTATGCGGAAATATAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003331
VALIDATED
TYK2 MISSION shRNA shRNA Plasmid DNA
tyrosine kinase 2
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003331.4-2171s21c1
Sequence:GTACCGGGCACAAGGACCAACGTGTATGCTCGAGCATACACGTTGGTCCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003331.4-1134s21c1
Sequence:GTACCGGGCAGATGGTCATGGTCAAATACTCGAGTATTTGACCATGACCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003331.4-4115s21c1
Sequence:CCGGCGTGAGCCTAACCATGATCTTCTCGAGAAGATCATGGTTAGGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003331.4-3246s21c1
Sequence:CCGGCGAGCACATCATCAAGTACAACTCGAGTTGTACTTGATGATGTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003331.4-3589s21c1
Sequence:CCGGGAGTGCCTGAAGGAGTATAAGCTCGAGCTTATACTCCTTCAGGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003331.4-901s21c1
Sequence:CCGGGAGATCCACCACTTTAAGAATCTCGAGATTCTTAAAGTGGTGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003331.4-666s21c1
Sequence:CCGGTGCAAGCCTGATGCTATATTTCTCGAGAAATATAGCATCAGGCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003331.x-864s1c1
Sequence:CCGGGAGATCCACCACTTTAAGAATCTCGAGATTCTTAAAGTGGTGGATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003331.x-2906s1c1
Sequence:CCGGGAGGCCATCATTCCGCACCATCTCGAGATGGTGCGGAATGATGGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003331.x-3209s1c1
Sequence:CCGGCGAGCACATCATCAAGTACAACTCGAGTTGTACTTGATGATGTGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003331.x-4078s1c1
Sequence:CCGGCGTGAGCCTAACCATGATCTTCTCGAGAAGATCATGGTTAGGCTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003331.x-533s1c1
Sequence:CCGGTGGTATCACTCCTCCTTGCTTCTCGAGAAGCAAGGAGGAGTGATACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199470    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003331.3-3999s1c1
Sequence:CCGGGATGTCAGCCTCACCCACACCCTCGAGGGTGTGGGTGAGGCTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003331.3-638s1c1
Sequence:CCGGGATGCTATATTTCCGCATAAGCTCGAGCTTATGCGGAAATATAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003331
VALIDATED
TYK2 MISSION shRNA Lentiviral Transduction Particles
tyrosine kinase 2
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003331.4-2171s21c1
Sequence:GTACCGGGCACAAGGACCAACGTGTATGCTCGAGCATACACGTTGGTCCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003331.4-1134s21c1
Sequence:GTACCGGGCAGATGGTCATGGTCAAATACTCGAGTATTTGACCATGACCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003331.4-4115s21c1
Sequence:CCGGCGTGAGCCTAACCATGATCTTCTCGAGAAGATCATGGTTAGGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003331.4-3246s21c1
Sequence:CCGGCGAGCACATCATCAAGTACAACTCGAGTTGTACTTGATGATGTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003331.4-3589s21c1
Sequence:CCGGGAGTGCCTGAAGGAGTATAAGCTCGAGCTTATACTCCTTCAGGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003331.4-901s21c1
Sequence:CCGGGAGATCCACCACTTTAAGAATCTCGAGATTCTTAAAGTGGTGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003331.4-666s21c1
Sequence:CCGGTGCAAGCCTGATGCTATATTTCTCGAGAAATATAGCATCAGGCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003331.x-864s1c1
Sequence:CCGGGAGATCCACCACTTTAAGAATCTCGAGATTCTTAAAGTGGTGGATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003331.x-2906s1c1
Sequence:CCGGGAGGCCATCATTCCGCACCATCTCGAGATGGTGCGGAATGATGGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003331.x-3209s1c1
Sequence:CCGGCGAGCACATCATCAAGTACAACTCGAGTTGTACTTGATGATGTGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003331.x-4078s1c1
Sequence:CCGGCGTGAGCCTAACCATGATCTTCTCGAGAAGATCATGGTTAGGCTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003331.x-533s1c1
Sequence:CCGGTGGTATCACTCCTCCTTGCTTCTCGAGAAGCAAGGAGGAGTGATACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199470    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003331.3-3999s1c1
Sequence:CCGGGATGTCAGCCTCACCCACACCCTCGAGGGTGTGGGTGAGGCTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003331.3-638s1c1
Sequence:CCGGGATGCTATATTTCCGCATAAGCTCGAGCTTATGCGGAAATATAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018793
VALIDATED
TYK2 MISSION shRNA Bacterial Glycerol Stock
tyrosine kinase 2
Mouse
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018793.2-606s21c1
Sequence:CCGGGGAACTGGCATGGCATGAATCCTCGAGGATTCATGCCATGCCAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018793.2-3941s21c1
Sequence:CCGGGACCTGAACAGACCTTGAATACTCGAGTATTCAAGGTCTGTTCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018793.2-3976s21c1
Sequence:CCGGTTGGGATTCCTGAGTCTATTCCTCGAGGAATAGACTCAGGAATCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018793.2-709s21c1
Sequence:CCGGGGACTCTGCCTCGTTTGAATACTCGAGTATTCAAACGAGGCAGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018793.2-3675s21c1
Sequence:CCGGGGTGTCCCTGTGAGATCTATCCTCGAGGATAGATCTCACAGGGACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018793.2-2014s21c1
Sequence:CCGGCAGGGTTCACCAGGATGAAATCTCGAGATTTCATCCTGGTGAACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018793.2-564s21c1
Sequence:CCGGCCCAAGACATGAACCTCTATTCTCGAGAATAGAGGTTCATGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018793.2-3115s21c1
Sequence:CCGGGACGCTGTACCACGAACATATCTCGAGATATGTTCGTGGTACAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018793.2-3856s21c1
Sequence:CCGGAGGCCTCCACACACCTTATACCTCGAGGTATAAGGTGTGTGGAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018793.2-910s21c1
Sequence:CCGGCAAGAACTGCATCCCTCATTCCTCGAGGAATGAGGGATGCAGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018793.2-1733s21c1
Sequence:CCGGCGAAACCCGGCTTTCAGTAATCTCGAGATTACTGAAAGCCGGGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018793.2-2208s21c1
Sequence:CCGGATATCGCCTTGGCCTTCTATGCTCGAGCATAGAAGGCCAAGGCGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018793.1-743s1c1
Sequence:CCGGCCACTTTAAGAATGAGAGCTTCTCGAGAAGCTCTCATTCTTAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018793.1-2451s1c1
Sequence:CCGGCCCTTCATCAAGCTAAGTGATCTCGAGATCACTTAGCTTGATGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025886    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018793.1-3968s1c1
Sequence:CCGGCCCATCTTCATTAGCTGGGAACTCGAGTTCCCAGCTAATGAAGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018793.1-500s1c1
Sequence:CCGGCCAAGACATGAACCTCTATTTCTCGAGAAATAGAGGTTCATGTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018793.1-2229s1c1
Sequence:CCGGCGTGGCTCAGAGAATATCATTCTCGAGAATGATATTCTCTGAGCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018793
VALIDATED
TYK2 MISSION shRNA shRNA Plasmid DNA
tyrosine kinase 2
Mouse
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018793.2-606s21c1
Sequence:CCGGGGAACTGGCATGGCATGAATCCTCGAGGATTCATGCCATGCCAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018793.2-3941s21c1
Sequence:CCGGGACCTGAACAGACCTTGAATACTCGAGTATTCAAGGTCTGTTCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018793.2-3976s21c1
Sequence:CCGGTTGGGATTCCTGAGTCTATTCCTCGAGGAATAGACTCAGGAATCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018793.2-709s21c1
Sequence:CCGGGGACTCTGCCTCGTTTGAATACTCGAGTATTCAAACGAGGCAGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018793.2-3675s21c1
Sequence:CCGGGGTGTCCCTGTGAGATCTATCCTCGAGGATAGATCTCACAGGGACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018793.2-2014s21c1
Sequence:CCGGCAGGGTTCACCAGGATGAAATCTCGAGATTTCATCCTGGTGAACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018793.2-564s21c1
Sequence:CCGGCCCAAGACATGAACCTCTATTCTCGAGAATAGAGGTTCATGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018793.2-3115s21c1
Sequence:CCGGGACGCTGTACCACGAACATATCTCGAGATATGTTCGTGGTACAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018793.2-3856s21c1
Sequence:CCGGAGGCCTCCACACACCTTATACCTCGAGGTATAAGGTGTGTGGAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018793.2-910s21c1
Sequence:CCGGCAAGAACTGCATCCCTCATTCCTCGAGGAATGAGGGATGCAGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018793.2-1733s21c1
Sequence:CCGGCGAAACCCGGCTTTCAGTAATCTCGAGATTACTGAAAGCCGGGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018793.2-2208s21c1
Sequence:CCGGATATCGCCTTGGCCTTCTATGCTCGAGCATAGAAGGCCAAGGCGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018793.1-743s1c1
Sequence:CCGGCCACTTTAAGAATGAGAGCTTCTCGAGAAGCTCTCATTCTTAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018793.1-2451s1c1
Sequence:CCGGCCCTTCATCAAGCTAAGTGATCTCGAGATCACTTAGCTTGATGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025886    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018793.1-3968s1c1
Sequence:CCGGCCCATCTTCATTAGCTGGGAACTCGAGTTCCCAGCTAATGAAGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018793.1-500s1c1
Sequence:CCGGCCAAGACATGAACCTCTATTTCTCGAGAAATAGAGGTTCATGTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018793.1-2229s1c1
Sequence:CCGGCGTGGCTCAGAGAATATCATTCTCGAGAATGATATTCTCTGAGCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018793
VALIDATED
TYK2 MISSION shRNA Lentiviral Transduction Particles
tyrosine kinase 2
Mouse
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018793.2-606s21c1
Sequence:CCGGGGAACTGGCATGGCATGAATCCTCGAGGATTCATGCCATGCCAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018793.2-3941s21c1
Sequence:CCGGGACCTGAACAGACCTTGAATACTCGAGTATTCAAGGTCTGTTCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018793.2-3976s21c1
Sequence:CCGGTTGGGATTCCTGAGTCTATTCCTCGAGGAATAGACTCAGGAATCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018793.2-709s21c1
Sequence:CCGGGGACTCTGCCTCGTTTGAATACTCGAGTATTCAAACGAGGCAGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018793.2-3675s21c1
Sequence:CCGGGGTGTCCCTGTGAGATCTATCCTCGAGGATAGATCTCACAGGGACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018793.2-2014s21c1
Sequence:CCGGCAGGGTTCACCAGGATGAAATCTCGAGATTTCATCCTGGTGAACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018793.2-564s21c1
Sequence:CCGGCCCAAGACATGAACCTCTATTCTCGAGAATAGAGGTTCATGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018793.2-3115s21c1
Sequence:CCGGGACGCTGTACCACGAACATATCTCGAGATATGTTCGTGGTACAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018793.2-3856s21c1
Sequence:CCGGAGGCCTCCACACACCTTATACCTCGAGGTATAAGGTGTGTGGAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018793.2-910s21c1
Sequence:CCGGCAAGAACTGCATCCCTCATTCCTCGAGGAATGAGGGATGCAGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018793.2-1733s21c1
Sequence:CCGGCGAAACCCGGCTTTCAGTAATCTCGAGATTACTGAAAGCCGGGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018793.2-2208s21c1
Sequence:CCGGATATCGCCTTGGCCTTCTATGCTCGAGCATAGAAGGCCAAGGCGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018793.1-743s1c1
Sequence:CCGGCCACTTTAAGAATGAGAGCTTCTCGAGAAGCTCTCATTCTTAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018793.1-2451s1c1
Sequence:CCGGCCCTTCATCAAGCTAAGTGATCTCGAGATCACTTAGCTTGATGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025886    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018793.1-3968s1c1
Sequence:CCGGCCCATCTTCATTAGCTGGGAACTCGAGTTCCCAGCTAATGAAGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018793.1-500s1c1
Sequence:CCGGCCAAGACATGAACCTCTATTTCTCGAGAAATAGAGGTTCATGTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018793.1-2229s1c1
Sequence:CCGGCGTGGCTCAGAGAATATCATTCTCGAGAATGATATTCTCTGAGCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks