EMAIL THIS PAGE TO A FRIEND

TYMP

thymidine phosphorylase

Synonyms: ECGF ECGF1 MEDPS1 MNGIE MTDPS1 PDECGF TP hPD-ECGF
Species: Human TYMP(1890), Mouse Tymp(72962), Rat Tymp(315219), naked mole-rat Tymp(101726492), domestic guinea pig Tymp(100724698)
UniProtKB ID: P19971, A8MW15, H9KVA0, Q13390, Q8WVB7
Gene ID:
Human(1890) Summary: This gene encodes an angiogenic factor which promotes angiogenesis in vivo and stimulates the in vitro growth of a variety of endothelial cells. It has a highly restricted target cell specificity acting only on endothelial cells. Mutations in this gene have been associated with mitochondrial neurogastrointestinal encephalomyopathy. Multiple alternatively spliced transcript variants have been identified. [provided by RefSeq, Apr 2012]
Mouse(72962) thymidine phosphorylase
Rat(315219) thymidine phosphorylase
naked mole-rat(101726492) thymidine phosphorylase
domestic guinea pig(100724698) thymidine phosphorylase
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
T0376 Thymine ≥99% mouse pricing
T0895 Thymine suitable for cell culture, BioReagent mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138302 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138302 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138302 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001953 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001953 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001953 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001113755 Rosetta Predictions human pricing
NM_001113756 Rosetta Predictions human pricing
NM_001953 Rosetta Predictions human pricing
NM_001012122 Rosetta Predictions rat pricing
XM_576326 Rosetta Predictions rat pricing
NM_138302 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113755 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326121 predicted 769
2 SASI_Hs02_00326122 predicted 850
3 SASI_Hs02_00326123 predicted 562
4 SASI_Hs02_00326124 predicted 606
5 SASI_Hs02_00326125 predicted 782
6 SASI_Hs02_00326126 predicted 768
7 SASI_Hs02_00326127 predicted 653
8 SASI_Hs02_00326128 predicted 652
9 SASI_Hs02_00326129 predicted 676
10 SASI_Hs02_00326130 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326131 predicted 689
2 SASI_Hs02_00326132 predicted 764
3 SASI_Hs02_00326133 predicted 482
4 SASI_Hs02_00326134 predicted 523
5 SASI_Hs02_00326135 predicted 694
6 SASI_Hs02_00326136 predicted 683
7 SASI_Hs02_00326137 predicted 562
8 SASI_Hs02_00326138 predicted 574
9 SASI_Hs02_00326139 predicted 596
10 SASI_Hs02_00326140 predicted 874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001953 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014173 predicted 757
2 SASI_Hs01_00014174 predicted 838
3 SASI_Hs01_00014177 predicted 551
4 SASI_Hs01_00014178 predicted 595
5 SASI_Hs02_00332883 predicted 769
6 SASI_Hs01_00014179 predicted 756
7 SASI_Hs01_00014180 predicted 633
8 SASI_Hs02_00332884 predicted 640
9 SASI_Hs01_00014182 predicted 667
10 SASI_Hs02_00332885 predicted 943
11 SASI_Hs01_00014175 predicted 606
12 SASI_Hs01_00014176 predicted 463
13 SASI_Hs01_00014181 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012122 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063636 predicted 663
2 SASI_Rn01_00063637 predicted 786
3 SASI_Rn01_00063639 predicted 885
4 SASI_Rn01_00063640 predicted 680
5 SASI_Rn01_00063641 predicted 500
6 SASI_Rn01_00063642 predicted 1320
7 SASI_Rn02_00200287 predicted 404
8 SASI_Rn01_00063643 predicted 204
9 SASI_Rn01_00063644 predicted 519
10 SASI_Rn01_00063645 predicted 608
11 SASI_Rn01_00063638 predicted 1622
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576326 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00196988 predicted 600
2 SASI_Rn01_00196989 predicted 662
3 SASI_Rn01_00196990 predicted 732
4 SASI_Rn01_00196991 predicted 1120
5 SASI_Rn01_00196992 predicted 828
6 SASI_Rn01_00196993 predicted 629
7 SASI_Rn01_00196994 predicted 446
8 SASI_Rn01_00196995 predicted 511
9 SASI_Rn01_00196996 predicted 898
10 SASI_Rn01_00196997 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138302 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086565 predicted 1466
2 SASI_Mm02_00339585 predicted 1429
3 SASI_Mm02_00339586 predicted 1535
4 SASI_Mm02_00339587 predicted 1473
5 SASI_Mm02_00339588 predicted 1550
6 SASI_Mm02_00339589 predicted 1433
7 SASI_Mm02_00339590 predicted 1743
8 SASI_Mm02_00339591 predicted 1588
9 SASI_Mm02_00339592 predicted 1394
10 SASI_Mm02_00339593 predicted 1532
11 SASI_Mm01_00086558 predicted 714
12 SASI_Mm01_00086559 predicted 254
13 SASI_Mm01_00086560 predicted 783
14 SASI_Mm01_00086561 predicted 611
15 SASI_Mm01_00086562 predicted 650
16 SASI_Mm01_00086563 predicted 877
17 SASI_Mm01_00086564 predicted 947
18 SASI_Mm01_00086566 predicted 675
19 SASI_Mm01_00086567 predicted 505
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138302
TYMP MISSION shRNA Bacterial Glycerol Stock
thymidine phosphorylase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138302.1-485s1c1
Sequence:CCGGGCACACTGGATAAGCTGGAATCTCGAGATTCCAGCTTATCCAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138302.1-660s1c1
Sequence:CCGGCCCACTCATTACAGCTTCAATCTCGAGATTGAAGCTGTAATGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138302.1-168s1c1
Sequence:CCGGGCATCTGAGAGAAGCAGATATCTCGAGATATCTGCTTCTCTCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138302.1-272s1c1
Sequence:CCGGGAATGAACCTAGAAGAGACATCTCGAGATGTCTCTTCTAGGTTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138302.1-775s1c1
Sequence:CCGGGAACTGGCAAAGATGTTGGTTCTCGAGAACCAACATCTTTGCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138302
TYMP MISSION shRNA shRNA Plasmid DNA
thymidine phosphorylase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138302.1-485s1c1
Sequence:CCGGGCACACTGGATAAGCTGGAATCTCGAGATTCCAGCTTATCCAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138302.1-660s1c1
Sequence:CCGGCCCACTCATTACAGCTTCAATCTCGAGATTGAAGCTGTAATGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138302.1-168s1c1
Sequence:CCGGGCATCTGAGAGAAGCAGATATCTCGAGATATCTGCTTCTCTCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138302.1-272s1c1
Sequence:CCGGGAATGAACCTAGAAGAGACATCTCGAGATGTCTCTTCTAGGTTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138302.1-775s1c1
Sequence:CCGGGAACTGGCAAAGATGTTGGTTCTCGAGAACCAACATCTTTGCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138302
TYMP MISSION shRNA Lentiviral Transduction Particles
thymidine phosphorylase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138302.1-485s1c1
Sequence:CCGGGCACACTGGATAAGCTGGAATCTCGAGATTCCAGCTTATCCAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138302.1-660s1c1
Sequence:CCGGCCCACTCATTACAGCTTCAATCTCGAGATTGAAGCTGTAATGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138302.1-168s1c1
Sequence:CCGGGCATCTGAGAGAAGCAGATATCTCGAGATATCTGCTTCTCTCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138302.1-272s1c1
Sequence:CCGGGAATGAACCTAGAAGAGACATCTCGAGATGTCTCTTCTAGGTTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138302.1-775s1c1
Sequence:CCGGGAACTGGCAAAGATGTTGGTTCTCGAGAACCAACATCTTTGCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001953
VALIDATED
TYMP MISSION shRNA Bacterial Glycerol Stock
thymidine phosphorylase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001953.2-1030s1c1
Sequence:CCGGGCCAGACTTAAGGGACCTGGTCTCGAGACCAGGTCCCTTAAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001953.2-604s1c1
Sequence:CCGGGCTGGAGTCTATTCCTGGATTCTCGAGAATCCAGGAATAGACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001953.2-241s1c1
Sequence:CCGGCCCGGAGCTGATCCGCATGAACTCGAGTTCATGCGGATCAGCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001953.2-594s1c1
Sequence:CCGGCCTTGGATAAGCTGGAGTCTACTCGAGTAGACTCCAGCTTATCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001953.2-779s1c1
Sequence:CCGGGCCTCCATTCTCAGTAAGAAACTCGAGTTTCTTACTGAGAATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001953.3-602s21c1
Sequence:CCGGGCTGCAAGGTGCCAATGATCACTCGAGTGATCATTGGCACCTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001953.3-879s21c1
Sequence:CCGGTCTGGTGGTGGACGTTAAGTTCTCGAGAACTTAACGTCCACCACCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001953
VALIDATED
TYMP MISSION shRNA shRNA Plasmid DNA
thymidine phosphorylase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001953.2-1030s1c1
Sequence:CCGGGCCAGACTTAAGGGACCTGGTCTCGAGACCAGGTCCCTTAAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001953.2-604s1c1
Sequence:CCGGGCTGGAGTCTATTCCTGGATTCTCGAGAATCCAGGAATAGACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001953.2-241s1c1
Sequence:CCGGCCCGGAGCTGATCCGCATGAACTCGAGTTCATGCGGATCAGCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001953.2-594s1c1
Sequence:CCGGCCTTGGATAAGCTGGAGTCTACTCGAGTAGACTCCAGCTTATCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001953.2-779s1c1
Sequence:CCGGGCCTCCATTCTCAGTAAGAAACTCGAGTTTCTTACTGAGAATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001953.3-602s21c1
Sequence:CCGGGCTGCAAGGTGCCAATGATCACTCGAGTGATCATTGGCACCTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001953.3-879s21c1
Sequence:CCGGTCTGGTGGTGGACGTTAAGTTCTCGAGAACTTAACGTCCACCACCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001953
VALIDATED
TYMP MISSION shRNA Lentiviral Transduction Particles
thymidine phosphorylase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001953.2-1030s1c1
Sequence:CCGGGCCAGACTTAAGGGACCTGGTCTCGAGACCAGGTCCCTTAAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001953.2-604s1c1
Sequence:CCGGGCTGGAGTCTATTCCTGGATTCTCGAGAATCCAGGAATAGACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001953.2-241s1c1
Sequence:CCGGCCCGGAGCTGATCCGCATGAACTCGAGTTCATGCGGATCAGCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001953.2-594s1c1
Sequence:CCGGCCTTGGATAAGCTGGAGTCTACTCGAGTAGACTCCAGCTTATCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001953.2-779s1c1
Sequence:CCGGGCCTCCATTCTCAGTAAGAAACTCGAGTTTCTTACTGAGAATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001953.3-602s21c1
Sequence:CCGGGCTGCAAGGTGCCAATGATCACTCGAGTGATCATTGGCACCTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001953.3-879s21c1
Sequence:CCGGTCTGGTGGTGGACGTTAAGTTCTCGAGAACTTAACGTCCACCACCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks