EMAIL THIS PAGE TO A FRIEND

TYMS

thymidylate synthetase

Synonyms: HST422 TMS TS
UniProtKB ID: P04818
Gene ID:
Human(7298) Summary: Thymidylate synthase catalyzes the methylation of deoxyuridylate to deoxythymidylate using 5,10-methylenetetrahydrofolate (methylene-THF) as a cofactor. This function maintains the dTMP (thymidine-5-prime monophosphate) pool critical for DNA replication and repair. The enzyme has been of interest as a target for cancer chemotherapeutic agents. It is considered to be the primary site of action for 5-fluorouracil, 5-fluoro-2-prime-deoxyuridine, and some folate analogs. Expression of this gene and that of a naturally occuring antisense transcript rTSalpha (GeneID:55556) vary inversely when cell-growth progresses from late-log to plateau phase. [provided by RefSeq, Jul 2008]
Mouse(22171) thymidylate synthase
Rat(29261) thymidylate synthetase
domestic guinea pig(100720541) thymidylate synthetase
naked mole-rat(101721263) thymidylate synthetase
cow(507631) thymidylate synthetase
Zebrafish(81540) thymidylate synthase
chicken(421060) thymidylate synthetase
dog(607417) thymidylate synthetase
domestic cat(101091231) thymidylate synthetase
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021288 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021288 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021288 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001071 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001071 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001071 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001071 Rosetta Predictions human pricing
NM_019179 Rosetta Predictions rat pricing
NM_021288 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001071 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097668 predicted 468
2 SASI_Hs02_00311888 predicted 883
3 SASI_Hs02_00311889 predicted 895
4 SASI_Hs02_00311890 predicted 903
5 SASI_Hs02_00311891 predicted 669
6 SASI_Hs01_00097671 predicted 583
7 SASI_Hs02_00311892 predicted 338
8 SASI_Hs01_00097673 predicted 529
9 SASI_Hs01_00097674 predicted 569
10 SASI_Hs01_00097677 predicted 871
11 SASI_Hs01_00097669 predicted 979
12 SASI_Hs01_00097670 predicted 1010
13 SASI_Hs01_00097672 predicted 1027
14 SASI_Hs01_00097675 predicted 1063
15 SASI_Hs01_00097676 predicted 1062
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019179 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261970 predicted 862
2 SASI_Rn01_00096030 predicted 866
3 SASI_Rn01_00096031 predicted 974
4 SASI_Rn01_00096032 predicted 417
5 SASI_Rn01_00096033 predicted 981
6 SASI_Rn01_00096036 predicted 298
7 SASI_Rn01_00096037 predicted 872
8 SASI_Rn02_00261971 predicted 908
9 SASI_Rn01_00096038 predicted 207
10 SASI_Rn01_00096039 predicted 841
11 SASI_Rn01_00096034 predicted 744
12 SASI_Rn01_00096035 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021288 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065234 predicted 1386
2 SASI_Mm01_00065235 predicted 1348
3 SASI_Mm01_00065238 predicted 827
4 SASI_Mm01_00065239 predicted 955
5 SASI_Mm01_00065240 predicted 938
6 SASI_Mm01_00065236 predicted 1376
7 SASI_Mm01_00065237 predicted 1403
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021288
VALIDATED
TYMS MISSION shRNA Bacterial Glycerol Stock
thymidylate synthetase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021288.3-779s21c1
Sequence:CCGGGCACATATTTACCTGAATCATCTCGAGATGATTCAGGTAAATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021288.3-447s21c1
Sequence:CCGGCAGAGTACAAAGATATGGATTCTCGAGAATCCATATCTTTGTACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021288.3-686s21c1
Sequence:CCGGCCCTTCAACATTGCCAGCTATCTCGAGATAGCTGGCAATGTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021288.3-1355s21c1
Sequence:CCGGCACCTCCAAGAGTAGCCATTACTCGAGTAATGGCTACTCTTGGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021288.3-235s21c1
Sequence:CCGGGCTCACAACCAAACGAGTGTTCTCGAGAACACTCGTTTGGTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021288.2-2548s1c1
Sequence:CCGGCCTGAGCTATTCTATCTCATTCTCGAGAATGAGATAGAATAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021288.2-780s1c1
Sequence:CCGGGCACATATTTACCTGAATCATCTCGAGATGATTCAGGTAAATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021288.2-448s1c1
Sequence:CCGGCAGAGTACAAAGATATGGATTCTCGAGAATCCATATCTTTGTACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021288.2-236s1c1
Sequence:CCGGGCTCACAACCAAACGAGTGTTCTCGAGAACACTCGTTTGGTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021288.2-687s1c1
Sequence:CCGGCCCTTCAACATTGCCAGCTATCTCGAGATAGCTGGCAATGTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021288
VALIDATED
TYMS MISSION shRNA shRNA Plasmid DNA
thymidylate synthetase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021288.3-779s21c1
Sequence:CCGGGCACATATTTACCTGAATCATCTCGAGATGATTCAGGTAAATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021288.3-447s21c1
Sequence:CCGGCAGAGTACAAAGATATGGATTCTCGAGAATCCATATCTTTGTACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021288.3-686s21c1
Sequence:CCGGCCCTTCAACATTGCCAGCTATCTCGAGATAGCTGGCAATGTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021288.3-1355s21c1
Sequence:CCGGCACCTCCAAGAGTAGCCATTACTCGAGTAATGGCTACTCTTGGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021288.3-235s21c1
Sequence:CCGGGCTCACAACCAAACGAGTGTTCTCGAGAACACTCGTTTGGTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021288.2-2548s1c1
Sequence:CCGGCCTGAGCTATTCTATCTCATTCTCGAGAATGAGATAGAATAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021288.2-780s1c1
Sequence:CCGGGCACATATTTACCTGAATCATCTCGAGATGATTCAGGTAAATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021288.2-448s1c1
Sequence:CCGGCAGAGTACAAAGATATGGATTCTCGAGAATCCATATCTTTGTACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021288.2-236s1c1
Sequence:CCGGGCTCACAACCAAACGAGTGTTCTCGAGAACACTCGTTTGGTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021288.2-687s1c1
Sequence:CCGGCCCTTCAACATTGCCAGCTATCTCGAGATAGCTGGCAATGTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021288
VALIDATED
TYMS MISSION shRNA Lentiviral Transduction Particles
thymidylate synthetase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021288.3-779s21c1
Sequence:CCGGGCACATATTTACCTGAATCATCTCGAGATGATTCAGGTAAATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021288.3-447s21c1
Sequence:CCGGCAGAGTACAAAGATATGGATTCTCGAGAATCCATATCTTTGTACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021288.3-686s21c1
Sequence:CCGGCCCTTCAACATTGCCAGCTATCTCGAGATAGCTGGCAATGTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021288.3-1355s21c1
Sequence:CCGGCACCTCCAAGAGTAGCCATTACTCGAGTAATGGCTACTCTTGGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021288.3-235s21c1
Sequence:CCGGGCTCACAACCAAACGAGTGTTCTCGAGAACACTCGTTTGGTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021288.2-2548s1c1
Sequence:CCGGCCTGAGCTATTCTATCTCATTCTCGAGAATGAGATAGAATAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021288.2-780s1c1
Sequence:CCGGGCACATATTTACCTGAATCATCTCGAGATGATTCAGGTAAATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021288.2-448s1c1
Sequence:CCGGCAGAGTACAAAGATATGGATTCTCGAGAATCCATATCTTTGTACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021288.2-236s1c1
Sequence:CCGGGCTCACAACCAAACGAGTGTTCTCGAGAACACTCGTTTGGTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021288.2-687s1c1
Sequence:CCGGCCCTTCAACATTGCCAGCTATCTCGAGATAGCTGGCAATGTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001071
VALIDATED
TYMS MISSION shRNA Bacterial Glycerol Stock
thymidylate synthetase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001071.2-873s21c1
Sequence:CCGGCAGGTGACTTTATACACACTTCTCGAGAAGTGTGTATAAAGTCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001071.2-358s21c1
Sequence:CCGGGCTGACAACCAAACGTGTGTTCTCGAGAACACACGTTTGGTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001071.2-622s21c1
Sequence:CCGGGCAAAGAGTGATTGACACCATCTCGAGATGGTGTCAATCACTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001071.2-652s21c1
Sequence:CCGGCCCTGACGACAGAAGAATCATCTCGAGATGATTCTTCTGTCGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001071.1-618s1c1
Sequence:CCGGCCCTGACGACAGAAGAATCATCTCGAGATGATTCTTCTGTCGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_001071.1-324s1c1
Sequence:CCGGGCTGACAACCAAACGTGTGTTCTCGAGAACACACGTTTGGTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001071.1-588s1c1
Sequence:CCGGGCAAAGAGTGATTGACACCATCTCGAGATGGTGTCAATCACTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_001071.1-857s1c1
Sequence:CCGGCTTTGGGAGATGCACATATTTCTCGAGAAATATGTGCATCTCCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_001071.1-839s1c1
Sequence:CCGGCAGGTGACTTTATACACACTTCTCGAGAAGTGTGTATAAAGTCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001071
VALIDATED
TYMS MISSION shRNA shRNA Plasmid DNA
thymidylate synthetase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001071.2-873s21c1
Sequence:CCGGCAGGTGACTTTATACACACTTCTCGAGAAGTGTGTATAAAGTCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001071.2-358s21c1
Sequence:CCGGGCTGACAACCAAACGTGTGTTCTCGAGAACACACGTTTGGTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001071.2-622s21c1
Sequence:CCGGGCAAAGAGTGATTGACACCATCTCGAGATGGTGTCAATCACTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001071.2-652s21c1
Sequence:CCGGCCCTGACGACAGAAGAATCATCTCGAGATGATTCTTCTGTCGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001071.1-618s1c1
Sequence:CCGGCCCTGACGACAGAAGAATCATCTCGAGATGATTCTTCTGTCGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_001071.1-324s1c1
Sequence:CCGGGCTGACAACCAAACGTGTGTTCTCGAGAACACACGTTTGGTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001071.1-588s1c1
Sequence:CCGGGCAAAGAGTGATTGACACCATCTCGAGATGGTGTCAATCACTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_001071.1-857s1c1
Sequence:CCGGCTTTGGGAGATGCACATATTTCTCGAGAAATATGTGCATCTCCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_001071.1-839s1c1
Sequence:CCGGCAGGTGACTTTATACACACTTCTCGAGAAGTGTGTATAAAGTCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001071
VALIDATED
TYMS MISSION shRNA Lentiviral Transduction Particles
thymidylate synthetase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001071.2-873s21c1
Sequence:CCGGCAGGTGACTTTATACACACTTCTCGAGAAGTGTGTATAAAGTCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001071.2-358s21c1
Sequence:CCGGGCTGACAACCAAACGTGTGTTCTCGAGAACACACGTTTGGTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001071.2-622s21c1
Sequence:CCGGGCAAAGAGTGATTGACACCATCTCGAGATGGTGTCAATCACTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001071.2-652s21c1
Sequence:CCGGCCCTGACGACAGAAGAATCATCTCGAGATGATTCTTCTGTCGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001071.1-618s1c1
Sequence:CCGGCCCTGACGACAGAAGAATCATCTCGAGATGATTCTTCTGTCGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_001071.1-324s1c1
Sequence:CCGGGCTGACAACCAAACGTGTGTTCTCGAGAACACACGTTTGGTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001071.1-588s1c1
Sequence:CCGGGCAAAGAGTGATTGACACCATCTCGAGATGGTGTCAATCACTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_001071.1-857s1c1
Sequence:CCGGCTTTGGGAGATGCACATATTTCTCGAGAAATATGTGCATCTCCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_001071.1-839s1c1
Sequence:CCGGCAGGTGACTTTATACACACTTCTCGAGAAGTGTGTATAAAGTCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks