EMAIL THIS PAGE TO A FRIEND

TYR

tyrosinase

Synonyms: CMM8 OCA1A OCAIA SHEP3
Gene ID:
Human(7299) Summary: The enzyme encoded by this gene catalyzes the first 2 steps, and at least 1 subsequent step, in the conversion of tyrosine to melanin. The enzyme has both tyrosine hydroxylase and dopa oxidase catalytic activities, and requires copper for function. Mutations in this gene result in oculocutaneous albinism, and nonpathologic polymorphisms result in skin pigmentation variation. The human genome contains a pseudogene similar to the 3' half of this gene. [provided by RefSeq, Oct 2008]
Mouse(22173) tyrosinase
Rat(308800) tyrosinase
Zebrafish(30207) tyrosinase
chicken(373971) tyrosinase (oculocutaneous albinism IA)
dog(403405) tyrosinase (oculocutaneous albinism IA)
domestic cat(751100) tyrosinase (oculocutaneous albinism IA)
cow(280951) tyrosinase (oculocutaneous albinism IA)
sheep(780502) tyrosinase (oculocutaneous albinism IA)
Domestic Rabbit(100008753) tyrosinase (oculocutaneous albinism IA)
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1406565 Anti-TYR antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2108026 Anti-TYR antibody produced in rabbit IgG fraction of antiserum rat, rabbit, mouse, human, horse, guinea pig, canine
western blot pricing
AV44269 Anti-TYR antibody produced in rabbit IgG fraction of antiserum, lyophilized powder mouse, canine, horse, human, rabbit, rat
western blot pricing
SAB1411374 Anti-TYR antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, western blot pricing
HPA043241 Anti-TYR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
HPA050889 Anti-TYR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB1306598 ANTI-TYROSINASE(C-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB4503051 Anti-Tyrosinase, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
WH0007299M1 Monoclonal Anti-TYR antibody produced in mouse clone 2A2-F4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
T9951 Monoclonal Anti-Tyrosinase antibody produced in mouse clone T311, purified immunoglobulin, buffered aqueous solution human
ELISA, immunocytochemistry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011661 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011661 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011661 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000372 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000372 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000372 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000372 Rosetta Predictions human pricing
NM_001107535 Rosetta Predictions rat pricing
NM_011661 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000372 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091687 predicted 968
2 SASI_Hs01_00091688 predicted 353
3 SASI_Hs01_00091690 predicted 504
4 SASI_Hs01_00091691 predicted 1160
5 SASI_Hs01_00091692 predicted 612
6 SASI_Hs01_00091693 predicted 893
7 SASI_Hs01_00091694 predicted 1243
8 SASI_Hs01_00091695 predicted 1097
9 SASI_Hs01_00091696 predicted 565
10 SASI_Hs02_00302426 predicted 1045
11 SASI_Hs01_00091689 predicted 1121
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107535 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229785 predicted 487
2 SASI_Rn02_00229786 predicted 1064
3 SASI_Rn02_00229787 predicted 1043
4 SASI_Rn02_00229788 predicted 336
5 SASI_Rn02_00229789 predicted 1033
6 SASI_Rn02_00229790 predicted 1182
7 SASI_Rn02_00229791 predicted 904
8 SASI_Rn02_00229792 predicted 1299
9 SASI_Rn02_00229793 predicted 412
10 SASI_Rn02_00229794 predicted 740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011661 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321158 predicted 481
2 SASI_Mm02_00321159 predicted 889
3 SASI_Mm02_00321160 predicted 1061
4 SASI_Mm02_00321161 predicted 657
5 SASI_Mm02_00321162 predicted 1035
6 SASI_Mm02_00321163 predicted 398
7 SASI_Mm02_00321164 predicted 425
8 SASI_Mm02_00321165 predicted 871
9 SASI_Mm02_00321166 predicted 1033
10 SASI_Mm02_00321167 predicted 1141
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011661
VALIDATED
TYR MISSION shRNA Bacterial Glycerol Stock
tyrosinase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011661.1-2420s1c1
Sequence:CCGGGCGATGGGAAACTATCTGAATCTCGAGATTCAGATAGTTTCCCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011661.1-1035s1c1
Sequence:CCGGCCCAGTATGAATCTGGATCAACTCGAGTTGATCCAGATTCATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011661.1-1354s1c1
Sequence:CCGGGCTCTATAGAAATGGTGATTTCTCGAGAAATCACCATTTCTATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011661.1-1036s1c1
Sequence:CCGGCCAGTATGAATCTGGATCAATCTCGAGATTGATCCAGATTCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011661.1-361s1c1
Sequence:CCGGCGGAAACTGTAAGTTTGGATTCTCGAGAATCCAAACTTACAGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011661
VALIDATED
TYR MISSION shRNA shRNA Plasmid DNA
tyrosinase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011661.1-2420s1c1
Sequence:CCGGGCGATGGGAAACTATCTGAATCTCGAGATTCAGATAGTTTCCCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011661.1-1035s1c1
Sequence:CCGGCCCAGTATGAATCTGGATCAACTCGAGTTGATCCAGATTCATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011661.1-1354s1c1
Sequence:CCGGGCTCTATAGAAATGGTGATTTCTCGAGAAATCACCATTTCTATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011661.1-1036s1c1
Sequence:CCGGCCAGTATGAATCTGGATCAATCTCGAGATTGATCCAGATTCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011661.1-361s1c1
Sequence:CCGGCGGAAACTGTAAGTTTGGATTCTCGAGAATCCAAACTTACAGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011661
VALIDATED
TYR MISSION shRNA Lentiviral Transduction Particles
tyrosinase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011661.1-2420s1c1
Sequence:CCGGGCGATGGGAAACTATCTGAATCTCGAGATTCAGATAGTTTCCCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011661.1-1035s1c1
Sequence:CCGGCCCAGTATGAATCTGGATCAACTCGAGTTGATCCAGATTCATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011661.1-1354s1c1
Sequence:CCGGGCTCTATAGAAATGGTGATTTCTCGAGAAATCACCATTTCTATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011661.1-1036s1c1
Sequence:CCGGCCAGTATGAATCTGGATCAATCTCGAGATTGATCCAGATTCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011661.1-361s1c1
Sequence:CCGGCGGAAACTGTAAGTTTGGATTCTCGAGAATCCAAACTTACAGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000372
TYR MISSION shRNA Bacterial Glycerol Stock
tyrosinase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000372.2-1126s1c1
Sequence:CCGGGCCTTGGCATAGACTCTTCTTCTCGAGAAGAAGAGTCTATGCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000372.2-995s1c1
Sequence:CCGGCCCATGTTTAACGACATCAATCTCGAGATTGATGTCGTTAAACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000372.2-775s1c1
Sequence:CCGGCTCTGGCAACTTCATGGGATTCTCGAGAATCCCATGAAGTTGCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000372.2-1595s1c1
Sequence:CCGGGCCTTGCACATCTATATGAATCTCGAGATTCATATAGATGTGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000372.2-1752s1c1
Sequence:CCGGCCATTGGACATAACCGGGAATCTCGAGATTCCCGGTTATGTCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000372.4-1465s21c1
Sequence:CCGGAGACTACATTAAGTCCTATTTCTCGAGAAATAGGACTTAATGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000372.4-1043s21c1
Sequence:CCGGTGCCTGAGTTTGACCCAATATCTCGAGATATTGGGTCAAACTCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000372.4-1651s21c1
Sequence:CCGGCTTGTATCAGAGCCATTTATACTCGAGTATAAATGGCTCTGATACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000372
TYR MISSION shRNA shRNA Plasmid DNA
tyrosinase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000372.2-1126s1c1
Sequence:CCGGGCCTTGGCATAGACTCTTCTTCTCGAGAAGAAGAGTCTATGCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000372.2-995s1c1
Sequence:CCGGCCCATGTTTAACGACATCAATCTCGAGATTGATGTCGTTAAACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000372.2-775s1c1
Sequence:CCGGCTCTGGCAACTTCATGGGATTCTCGAGAATCCCATGAAGTTGCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000372.2-1595s1c1
Sequence:CCGGGCCTTGCACATCTATATGAATCTCGAGATTCATATAGATGTGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000372.2-1752s1c1
Sequence:CCGGCCATTGGACATAACCGGGAATCTCGAGATTCCCGGTTATGTCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000372.4-1465s21c1
Sequence:CCGGAGACTACATTAAGTCCTATTTCTCGAGAAATAGGACTTAATGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000372.4-1043s21c1
Sequence:CCGGTGCCTGAGTTTGACCCAATATCTCGAGATATTGGGTCAAACTCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000372.4-1651s21c1
Sequence:CCGGCTTGTATCAGAGCCATTTATACTCGAGTATAAATGGCTCTGATACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000372
TYR MISSION shRNA Lentiviral Transduction Particles
tyrosinase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000372.2-1126s1c1
Sequence:CCGGGCCTTGGCATAGACTCTTCTTCTCGAGAAGAAGAGTCTATGCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000372.2-995s1c1
Sequence:CCGGCCCATGTTTAACGACATCAATCTCGAGATTGATGTCGTTAAACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000372.2-775s1c1
Sequence:CCGGCTCTGGCAACTTCATGGGATTCTCGAGAATCCCATGAAGTTGCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000372.2-1595s1c1
Sequence:CCGGGCCTTGCACATCTATATGAATCTCGAGATTCATATAGATGTGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000372.2-1752s1c1
Sequence:CCGGCCATTGGACATAACCGGGAATCTCGAGATTCCCGGTTATGTCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000372.4-1465s21c1
Sequence:CCGGAGACTACATTAAGTCCTATTTCTCGAGAAATAGGACTTAATGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000372.4-1043s21c1
Sequence:CCGGTGCCTGAGTTTGACCCAATATCTCGAGATATTGGGTCAAACTCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000372.4-1651s21c1
Sequence:CCGGCTTGTATCAGAGCCATTTATACTCGAGTATAAATGGCTCTGATACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks