EMAIL THIS PAGE TO A FRIEND

TYRO3

TYRO3 protein tyrosine kinase

Synonyms: BYK Dtk RSE Sky Tif
UniProtKB ID: Q06418, O14953, Q86VR3
Gene ID:
Human(7301) Summary: The gene is part of a 3-member transmembrane receptor kinase receptor family with a processed pseudogene distal on chromosome 15. The encoded protein is activated by the products of the growth arrest-specific gene 6 and protein S genes and is involved in controlling cell survival and proliferation, spermatogenesis, immunoregulation and phagocytosis. The encoded protein has also been identified as a cell entry factor for Ebola and Marburg viruses. [provided by RefSeq, May 2010]
Mouse(22174) TYRO3 protein tyrosine kinase 3
Rat(25232) TYRO3 protein tyrosine kinase
Zebrafish(30709) TYRO3 protein tyrosine kinase
chicken(395336) TYRO3 protein tyrosine kinase
dog(487509) TYRO3 protein tyrosine kinase
domestic cat(101083854) TYRO3 protein tyrosine kinase
domestic guinea pig(100720457) TYRO3 protein tyrosine kinase
naked mole-rat(101699773) TYRO3 protein tyrosine kinase
cow(788224) TYRO3 protein tyrosine kinase
sheep(101116151) TYRO3 protein tyrosine kinase
148 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006293 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006293 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006293 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019392 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019392 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019392 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006293 siRNAs that have been validated in the lab human pricing
NM_017092 Rosetta Predictions rat pricing
NM_019392 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006293 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062998 validated 2417
1 SASI_Hs01_00062999 validated 2470
1 SASI_Hs01_00063000 validated 873
2 SASI_Hs02_00341287 predicted 1785
3 SASI_Hs01_00063003 predicted 2484
4 SASI_Hs01_00063005 predicted 919
5 SASI_Hs02_00341288 predicted 1355
6 SASI_Hs02_00341289 predicted 1215
7 SASI_Hs02_00341290 predicted 2272
8 SASI_Hs02_00341291 predicted 2831
9 SASI_Hs02_00341292 predicted 927
10 SASI_Hs01_00063001 predicted 1879
11 SASI_Hs01_00063002 predicted 2347
12 SASI_Hs01_00063004 predicted 2561
13 SASI_Hs01_00063006 predicted 2195
14 SASI_Hs01_00063007 predicted 2435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017092 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101896 predicted 969
2 SASI_Rn01_00101897 predicted 1001
3 SASI_Rn01_00101898 predicted 1455
4 SASI_Rn01_00101899 predicted 367
5 SASI_Rn01_00101900 predicted 1111
6 SASI_Rn01_00101901 predicted 1565
7 SASI_Rn01_00101902 predicted 2004
8 SASI_Rn01_00101903 predicted 290
9 SASI_Rn01_00101904 predicted 596
10 SASI_Rn02_00261308 predicted 2046
11 SASI_Rn01_00101895 predicted 1129
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019392 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046923 predicted 2903
2 SASI_Mm01_00046925 predicted 755
3 SASI_Mm01_00046926 predicted 1214
4 SASI_Mm01_00046927 predicted 2213
5 SASI_Mm01_00046928 predicted 1248
6 SASI_Mm01_00046929 predicted 2360
7 SASI_Mm02_00324314 predicted 1378
8 SASI_Mm01_00046930 predicted 1894
9 SASI_Mm01_00046931 predicted 2295
10 SASI_Mm02_00324315 predicted 1819
11 SASI_Mm01_00046924 predicted 1717
12 SASI_Mm01_00046932 predicted 932
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006293
VALIDATED
TYRO3 MISSION shRNA Bacterial Glycerol Stock
TYRO3 protein tyrosine kinase
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006293.2-909s21c1
Sequence:GTACCGGTTCAACATCACCGTGACAAAGCTCGAGCTTTGTCACGGTGATGTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006293.2-1718s21c1
Sequence:GTACCGGGGGCATCAGCGATGAACTAAACTCGAGTTTAGTTCATCGCTGATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_006293.2-1891s21c1
Sequence:CCGGTCATTGCCTCAAGCGACATTGCTCGAGCAATGTCGCTTGAGGCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006293.2-2755s21c1
Sequence:CCGGCCAGTGACTGTCGGTACATACCTCGAGGTATGTACCGACAGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006293.2-3412s21c1
Sequence:CCGGTTGGTATCTCAGGTCTGAATCCTCGAGGATTCAGACCTGAGATACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006293.2-2491s21c1
Sequence:CCGGAGTGTATGGAGGACGTGTATGCTCGAGCATACACGTCCTCCATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006293.2-1664s21c1
Sequence:CCGGCCGGTCCTTCAATCGAGAAAGCTCGAGCTTTCTCGATTGAAGGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006293.2-2596s1c1
Sequence:CCGGGCCAGCTGTCTGTGCTATCTGCTCGAGCAGATAGCACAGACAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006293.2-1563s1c1
Sequence:CCGGGCCCTCATCCTGCTTCGAAAGCTCGAGCTTTCGAAGCAGGATGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195586    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006293.2-3728s1c1
Sequence:CCGGCCCTTCTAAACGGTGACCTTTCTCGAGAAAGGTCACCGTTTAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006293.2-3362s1c1
Sequence:CCGGCAAAGAGATGTCCTTGTAATACTCGAGTATTACAAGGACATCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006293.2-719s1c1
Sequence:CCGGCCCTGAACCTGTTACCATTGTCTCGAGACAATGGTAACAGGTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197199    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006293.2-3267s1c1
Sequence:CCGGGCTGCTTAAGTGCATGCATTGCTCGAGCAATGCATGCACTTAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006293.x-2490s1c1
Sequence:CCGGGAGTGTATGGAGGACGTGTATCTCGAGATACACGTCCTCCATACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006293.x-743s1c1
Sequence:CCGGGTGGAGAGGAACTACGAAGATCTCGAGATCTTCGTAGTTCCTCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006293.x-2554s1c1
Sequence:CCGGCGAGCTTTACTTGTCTGCGAACTCGAGTTCGCAGACAAGTAAAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002181    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_006293.x-3645s1c1
Sequence:CCGGCCTTCTCCATACCCACAATCTCTCGAGAGATTGTGGGTATGGAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006293
VALIDATED
TYRO3 MISSION shRNA shRNA Plasmid DNA
TYRO3 protein tyrosine kinase
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006293.2-909s21c1
Sequence:GTACCGGTTCAACATCACCGTGACAAAGCTCGAGCTTTGTCACGGTGATGTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006293.2-1718s21c1
Sequence:GTACCGGGGGCATCAGCGATGAACTAAACTCGAGTTTAGTTCATCGCTGATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_006293.2-1891s21c1
Sequence:CCGGTCATTGCCTCAAGCGACATTGCTCGAGCAATGTCGCTTGAGGCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006293.2-2755s21c1
Sequence:CCGGCCAGTGACTGTCGGTACATACCTCGAGGTATGTACCGACAGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006293.2-3412s21c1
Sequence:CCGGTTGGTATCTCAGGTCTGAATCCTCGAGGATTCAGACCTGAGATACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006293.2-2491s21c1
Sequence:CCGGAGTGTATGGAGGACGTGTATGCTCGAGCATACACGTCCTCCATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006293.2-1664s21c1
Sequence:CCGGCCGGTCCTTCAATCGAGAAAGCTCGAGCTTTCTCGATTGAAGGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006293.2-2596s1c1
Sequence:CCGGGCCAGCTGTCTGTGCTATCTGCTCGAGCAGATAGCACAGACAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006293.2-1563s1c1
Sequence:CCGGGCCCTCATCCTGCTTCGAAAGCTCGAGCTTTCGAAGCAGGATGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195586    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006293.2-3728s1c1
Sequence:CCGGCCCTTCTAAACGGTGACCTTTCTCGAGAAAGGTCACCGTTTAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006293.2-3362s1c1
Sequence:CCGGCAAAGAGATGTCCTTGTAATACTCGAGTATTACAAGGACATCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006293.2-719s1c1
Sequence:CCGGCCCTGAACCTGTTACCATTGTCTCGAGACAATGGTAACAGGTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197199    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006293.2-3267s1c1
Sequence:CCGGGCTGCTTAAGTGCATGCATTGCTCGAGCAATGCATGCACTTAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006293.x-2490s1c1
Sequence:CCGGGAGTGTATGGAGGACGTGTATCTCGAGATACACGTCCTCCATACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006293.x-743s1c1
Sequence:CCGGGTGGAGAGGAACTACGAAGATCTCGAGATCTTCGTAGTTCCTCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006293.x-2554s1c1
Sequence:CCGGCGAGCTTTACTTGTCTGCGAACTCGAGTTCGCAGACAAGTAAAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002181    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_006293.x-3645s1c1
Sequence:CCGGCCTTCTCCATACCCACAATCTCTCGAGAGATTGTGGGTATGGAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006293
VALIDATED
TYRO3 MISSION shRNA Lentiviral Transduction Particles
TYRO3 protein tyrosine kinase
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006293.2-909s21c1
Sequence:GTACCGGTTCAACATCACCGTGACAAAGCTCGAGCTTTGTCACGGTGATGTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006293.2-1718s21c1
Sequence:GTACCGGGGGCATCAGCGATGAACTAAACTCGAGTTTAGTTCATCGCTGATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_006293.2-1891s21c1
Sequence:CCGGTCATTGCCTCAAGCGACATTGCTCGAGCAATGTCGCTTGAGGCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006293.2-2755s21c1
Sequence:CCGGCCAGTGACTGTCGGTACATACCTCGAGGTATGTACCGACAGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006293.2-3412s21c1
Sequence:CCGGTTGGTATCTCAGGTCTGAATCCTCGAGGATTCAGACCTGAGATACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006293.2-2491s21c1
Sequence:CCGGAGTGTATGGAGGACGTGTATGCTCGAGCATACACGTCCTCCATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006293.2-1664s21c1
Sequence:CCGGCCGGTCCTTCAATCGAGAAAGCTCGAGCTTTCTCGATTGAAGGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006293.2-2596s1c1
Sequence:CCGGGCCAGCTGTCTGTGCTATCTGCTCGAGCAGATAGCACAGACAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006293.2-1563s1c1
Sequence:CCGGGCCCTCATCCTGCTTCGAAAGCTCGAGCTTTCGAAGCAGGATGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195586    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006293.2-3728s1c1
Sequence:CCGGCCCTTCTAAACGGTGACCTTTCTCGAGAAAGGTCACCGTTTAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006293.2-3362s1c1
Sequence:CCGGCAAAGAGATGTCCTTGTAATACTCGAGTATTACAAGGACATCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006293.2-719s1c1
Sequence:CCGGCCCTGAACCTGTTACCATTGTCTCGAGACAATGGTAACAGGTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197199    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006293.2-3267s1c1
Sequence:CCGGGCTGCTTAAGTGCATGCATTGCTCGAGCAATGCATGCACTTAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006293.x-2490s1c1
Sequence:CCGGGAGTGTATGGAGGACGTGTATCTCGAGATACACGTCCTCCATACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006293.x-743s1c1
Sequence:CCGGGTGGAGAGGAACTACGAAGATCTCGAGATCTTCGTAGTTCCTCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006293.x-2554s1c1
Sequence:CCGGCGAGCTTTACTTGTCTGCGAACTCGAGTTCGCAGACAAGTAAAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002181    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_006293.x-3645s1c1
Sequence:CCGGCCTTCTCCATACCCACAATCTCTCGAGAGATTGTGGGTATGGAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019392
TYRO3 MISSION shRNA Bacterial Glycerol Stock
TYRO3 protein tyrosine kinase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019392.2-2208s21c1
Sequence:CCGGAGACCTAGCAGCTCGGAATTGCTCGAGCAATTCCGAGCTGCTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019392.2-851s21c1
Sequence:CCGGCTTGTGAAGCCCGCAACATAACTCGAGTTATGTTGCGGGCTTCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019392.2-1913s21c1
Sequence:CCGGTCATTGCCTCAAGCGACATAGCTCGAGCTATGTCGCTTGAGGCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019392.2-3269s21c1
Sequence:CCGGGGCTGAGCTGCTCCTACTTTACTCGAGTAAAGTAGGAGCAGCTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019392.1-1166s1c1
Sequence:CCGGCCTCAGAATTTCCATGCCATTCTCGAGAATGGCATGGAAATTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019392.1-1628s1c1
Sequence:CCGGGCCCGATCTTTCAATCGAGAACTCGAGTTCTCGATTGAAAGATCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019392.1-2382s1c1
Sequence:CCGGCGCCATATGCTGGCATTGAAACTCGAGTTTCAATGCCAGCATATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019392.1-1895s1c1
Sequence:CCGGGCAGCTTGCATGAAGGAGTTTCTCGAGAAACTCCTTCATGCAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019392
TYRO3 MISSION shRNA shRNA Plasmid DNA
TYRO3 protein tyrosine kinase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019392.2-2208s21c1
Sequence:CCGGAGACCTAGCAGCTCGGAATTGCTCGAGCAATTCCGAGCTGCTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019392.2-851s21c1
Sequence:CCGGCTTGTGAAGCCCGCAACATAACTCGAGTTATGTTGCGGGCTTCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019392.2-1913s21c1
Sequence:CCGGTCATTGCCTCAAGCGACATAGCTCGAGCTATGTCGCTTGAGGCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019392.2-3269s21c1
Sequence:CCGGGGCTGAGCTGCTCCTACTTTACTCGAGTAAAGTAGGAGCAGCTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019392.1-1166s1c1
Sequence:CCGGCCTCAGAATTTCCATGCCATTCTCGAGAATGGCATGGAAATTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019392.1-1628s1c1
Sequence:CCGGGCCCGATCTTTCAATCGAGAACTCGAGTTCTCGATTGAAAGATCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019392.1-2382s1c1
Sequence:CCGGCGCCATATGCTGGCATTGAAACTCGAGTTTCAATGCCAGCATATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019392.1-1895s1c1
Sequence:CCGGGCAGCTTGCATGAAGGAGTTTCTCGAGAAACTCCTTCATGCAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019392
TYRO3 MISSION shRNA Lentiviral Transduction Particles
TYRO3 protein tyrosine kinase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019392.2-2208s21c1
Sequence:CCGGAGACCTAGCAGCTCGGAATTGCTCGAGCAATTCCGAGCTGCTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019392.2-851s21c1
Sequence:CCGGCTTGTGAAGCCCGCAACATAACTCGAGTTATGTTGCGGGCTTCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019392.2-1913s21c1
Sequence:CCGGTCATTGCCTCAAGCGACATAGCTCGAGCTATGTCGCTTGAGGCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019392.2-3269s21c1
Sequence:CCGGGGCTGAGCTGCTCCTACTTTACTCGAGTAAAGTAGGAGCAGCTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019392.1-1166s1c1
Sequence:CCGGCCTCAGAATTTCCATGCCATTCTCGAGAATGGCATGGAAATTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019392.1-1628s1c1
Sequence:CCGGGCCCGATCTTTCAATCGAGAACTCGAGTTCTCGATTGAAAGATCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019392.1-2382s1c1
Sequence:CCGGCGCCATATGCTGGCATTGAAACTCGAGTTTCAATGCCAGCATATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019392.1-1895s1c1
Sequence:CCGGGCAGCTTGCATGAAGGAGTTTCTCGAGAAACTCCTTCATGCAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks