EMAIL THIS PAGE TO A FRIEND

TYROBP

TYRO protein tyrosine kinase binding protein

Synonyms: DAP12 KARAP PLOSL
UniProtKB ID: O43914, A8K2X0, F5H389, Q6FGA5, Q9UMT3
Gene ID:
Human(7305) Summary: This gene encodes a transmembrane signaling polypeptide which contains an immunoreceptor tyrosine-based activation motif (ITAM) in its cytoplasmic domain. The encoded protein may associate with the killer-cell inhibitory receptor (KIR) family of membrane glycoproteins and may act as an activating signal transduction element. This protein may bind zeta-chain (TCR) associated protein kinase 70kDa (ZAP-70) and spleen tyrosine kinase (SYK) and play a role in signal transduction, bone modeling, brain myelination, and inflammation. Mutations within this gene have been associated with polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy (PLOSL), also known as Nasu-Hakola disease. Its putative receptor, triggering receptor expressed on myeloid cells 2 (TREM2), also causes PLOSL. Multiple alternative transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Mar 2010]
Mouse(22177) TYRO protein tyrosine kinase binding protein
Rat(361537) Tyro protein tyrosine kinase binding protein
Zebrafish(100101461) TYRO protein tyrosine kinase binding protein
domestic cat(101082964) TYRO protein tyrosine kinase binding protein
dog(476477) TYRO protein tyrosine kinase binding protein
cow(282390) TYRO protein tyrosine kinase binding protein
sheep(443208) TYRO protein tyrosine kinase binding protein
naked mole-rat(101707522) TYRO protein tyrosine kinase binding protein
domestic guinea pig(100726186) TYRO protein tyrosine kinase binding protein
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003332 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003332 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003332 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011662 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011662 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011662 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU033221 MISSION® esiRNA esiRNA human TYROBP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003332 Rosetta Predictions human pricing
NM_198125 Rosetta Predictions human pricing
NM_212525 Rosetta Predictions rat pricing
NM_011662 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003332 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037064 predicted 270
2 SASI_Hs01_00037065 predicted 218
3 SASI_Hs01_00037066 predicted 199
4 SASI_Hs01_00037067 predicted 318
5 SASI_Hs01_00037068 predicted 335
6 SASI_Hs01_00037069 predicted 316
7 SASI_Hs01_00037070 predicted 314
8 SASI_Hs01_00037071 predicted 308
9 SASI_Hs01_00037072 predicted 292
10 SASI_Hs01_00037073 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198125 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112554 predicted 274
2 SASI_Hs01_00112555 predicted 213
3 SASI_Hs01_00112556 predicted 198
4 SASI_Hs01_00112557 predicted 272
5 SASI_Hs01_00112558 predicted 309
6 SASI_Hs01_00112559 predicted 334
7 SASI_Hs01_00112560 predicted 311
8 SASI_Hs01_00112561 predicted 307
9 SASI_Hs01_00112562 predicted 305
10 SASI_Hs01_00112563 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212525 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099593 predicted 265
2 SASI_Rn01_00099594 predicted 290
3 SASI_Rn01_00099595 predicted 261
4 SASI_Rn01_00099596 predicted 254
5 SASI_Rn01_00099597 predicted 260
6 SASI_Rn01_00099599 predicted 264
7 SASI_Rn01_00099600 predicted 298
8 SASI_Rn01_00099601 predicted 262
9 SASI_Rn01_00099602 predicted 240
10 SASI_Rn02_00270549 predicted 235
11 SASI_Rn01_00099598 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011662 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094923 predicted 301
2 SASI_Mm01_00094924 predicted 199
3 SASI_Mm02_00321168 predicted 315
4 SASI_Mm01_00094925 predicted 272
5 SASI_Mm01_00094927 predicted 315
6 SASI_Mm01_00094928 predicted 299
7 SASI_Mm01_00094929 predicted 307
8 SASI_Mm01_00094930 predicted 342
9 SASI_Mm01_00094931 predicted 302
10 SASI_Mm01_00094932 predicted 288
11 SASI_Mm01_00094926 predicted 285
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003332
TYROBP MISSION shRNA Bacterial Glycerol Stock
TYRO protein tyrosine kinase binding protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003332.2-145s1c1
Sequence:CCGGAGAGCGATTGCAGTTGCTCTACTCGAGTAGAGCAACTGCAATCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003332.2-370s1c1
Sequence:CCGGTCAACACACAGAGGCCGTATTCTCGAGAATACGGCCTCTGTGTGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003332.2-96s1c1
Sequence:CCGGCCTCTCCTGCTGGCTGTAAGTCTCGAGACTTACAGCCAGCAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003332.2-352s1c1
Sequence:CCGGCGGATGTCTACAGCGACCTCACTCGAGTGAGGTCGCTGTAGACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003332.2-289s1c1
Sequence:CCGGCGACCCGGAAACAGCGTATCACTCGAGTGATACGCTGTTTCCGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003332.3-430s21c1
Sequence:CCGGATCATGACAGTCAGCAACATGCTCGAGCATGTTGCTGACTGTCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003332.3-450s21c1
Sequence:CCGGGATACCTGGATCCAGCCATTCCTCGAGGAATGGCTGGATCCAGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003332.3-412s21c1
Sequence:CCGGTATTACAAATGAGCCCGAATCCTCGAGGATTCGGGCTCATTTGTAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003332
TYROBP MISSION shRNA shRNA Plasmid DNA
TYRO protein tyrosine kinase binding protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003332.2-145s1c1
Sequence:CCGGAGAGCGATTGCAGTTGCTCTACTCGAGTAGAGCAACTGCAATCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003332.2-370s1c1
Sequence:CCGGTCAACACACAGAGGCCGTATTCTCGAGAATACGGCCTCTGTGTGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003332.2-96s1c1
Sequence:CCGGCCTCTCCTGCTGGCTGTAAGTCTCGAGACTTACAGCCAGCAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003332.2-352s1c1
Sequence:CCGGCGGATGTCTACAGCGACCTCACTCGAGTGAGGTCGCTGTAGACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003332.2-289s1c1
Sequence:CCGGCGACCCGGAAACAGCGTATCACTCGAGTGATACGCTGTTTCCGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003332.3-430s21c1
Sequence:CCGGATCATGACAGTCAGCAACATGCTCGAGCATGTTGCTGACTGTCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003332.3-450s21c1
Sequence:CCGGGATACCTGGATCCAGCCATTCCTCGAGGAATGGCTGGATCCAGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003332.3-412s21c1
Sequence:CCGGTATTACAAATGAGCCCGAATCCTCGAGGATTCGGGCTCATTTGTAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003332
TYROBP MISSION shRNA Lentiviral Transduction Particles
TYRO protein tyrosine kinase binding protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003332.2-145s1c1
Sequence:CCGGAGAGCGATTGCAGTTGCTCTACTCGAGTAGAGCAACTGCAATCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003332.2-370s1c1
Sequence:CCGGTCAACACACAGAGGCCGTATTCTCGAGAATACGGCCTCTGTGTGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003332.2-96s1c1
Sequence:CCGGCCTCTCCTGCTGGCTGTAAGTCTCGAGACTTACAGCCAGCAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003332.2-352s1c1
Sequence:CCGGCGGATGTCTACAGCGACCTCACTCGAGTGAGGTCGCTGTAGACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003332.2-289s1c1
Sequence:CCGGCGACCCGGAAACAGCGTATCACTCGAGTGATACGCTGTTTCCGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003332.3-430s21c1
Sequence:CCGGATCATGACAGTCAGCAACATGCTCGAGCATGTTGCTGACTGTCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003332.3-450s21c1
Sequence:CCGGGATACCTGGATCCAGCCATTCCTCGAGGAATGGCTGGATCCAGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003332.3-412s21c1
Sequence:CCGGTATTACAAATGAGCCCGAATCCTCGAGGATTCGGGCTCATTTGTAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011662
TYROBP MISSION shRNA Bacterial Glycerol Stock
TYRO protein tyrosine kinase binding protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011662.2-366s1c1
Sequence:CCGGCCTCAACACACAGAGGCAATACTCGAGTATTGCCTCTGTGTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011662.2-316s1c1
Sequence:CCGGGAGTCGCCTTATCAGGAGCTTCTCGAGAAGCTCCTGATAAGGCGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011662.2-133s1c1
Sequence:CCGGCAGAGTGACACTTTCCCAAGACTCGAGTCTTGGGAAAGTGTCACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011662.2-307s1c1
Sequence:CCGGGCTGAGACTGAGTCGCCTTATCTCGAGATAAGGCGACTCAGTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011662.2-291s1c1
Sequence:CCGGCCGGAAACAACACATTGCTGACTCGAGTCAGCAATGTGTTGTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011662.2-209s21c1
Sequence:CCGGTGGTGTTGACTCTGCTGATTGCTCGAGCAATCAGCAGAGTCAACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011662.2-369s21c1
Sequence:CCGGCAACACACAGAGGCAATATTACTCGAGTAATATTGCCTCTGTGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011662.2-99s21c1
Sequence:CCGGCCTGACTGTGGGAGGATTAAGCTCGAGCTTAATCCTCCCACAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011662.2-308s21c1
Sequence:CCGGCTGAGACTGAGTCGCCTTATCCTCGAGGATAAGGCGACTCAGTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011662
TYROBP MISSION shRNA shRNA Plasmid DNA
TYRO protein tyrosine kinase binding protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011662.2-366s1c1
Sequence:CCGGCCTCAACACACAGAGGCAATACTCGAGTATTGCCTCTGTGTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011662.2-316s1c1
Sequence:CCGGGAGTCGCCTTATCAGGAGCTTCTCGAGAAGCTCCTGATAAGGCGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011662.2-133s1c1
Sequence:CCGGCAGAGTGACACTTTCCCAAGACTCGAGTCTTGGGAAAGTGTCACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011662.2-307s1c1
Sequence:CCGGGCTGAGACTGAGTCGCCTTATCTCGAGATAAGGCGACTCAGTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011662.2-291s1c1
Sequence:CCGGCCGGAAACAACACATTGCTGACTCGAGTCAGCAATGTGTTGTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011662.2-209s21c1
Sequence:CCGGTGGTGTTGACTCTGCTGATTGCTCGAGCAATCAGCAGAGTCAACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011662.2-369s21c1
Sequence:CCGGCAACACACAGAGGCAATATTACTCGAGTAATATTGCCTCTGTGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011662.2-99s21c1
Sequence:CCGGCCTGACTGTGGGAGGATTAAGCTCGAGCTTAATCCTCCCACAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011662.2-308s21c1
Sequence:CCGGCTGAGACTGAGTCGCCTTATCCTCGAGGATAAGGCGACTCAGTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011662
TYROBP MISSION shRNA Lentiviral Transduction Particles
TYRO protein tyrosine kinase binding protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011662.2-366s1c1
Sequence:CCGGCCTCAACACACAGAGGCAATACTCGAGTATTGCCTCTGTGTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011662.2-316s1c1
Sequence:CCGGGAGTCGCCTTATCAGGAGCTTCTCGAGAAGCTCCTGATAAGGCGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011662.2-133s1c1
Sequence:CCGGCAGAGTGACACTTTCCCAAGACTCGAGTCTTGGGAAAGTGTCACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011662.2-307s1c1
Sequence:CCGGGCTGAGACTGAGTCGCCTTATCTCGAGATAAGGCGACTCAGTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011662.2-291s1c1
Sequence:CCGGCCGGAAACAACACATTGCTGACTCGAGTCAGCAATGTGTTGTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011662.2-209s21c1
Sequence:CCGGTGGTGTTGACTCTGCTGATTGCTCGAGCAATCAGCAGAGTCAACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011662.2-369s21c1
Sequence:CCGGCAACACACAGAGGCAATATTACTCGAGTAATATTGCCTCTGTGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011662.2-99s21c1
Sequence:CCGGCCTGACTGTGGGAGGATTAAGCTCGAGCTTAATCCTCCCACAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011662.2-308s21c1
Sequence:CCGGCTGAGACTGAGTCGCCTTATCCTCGAGGATAAGGCGACTCAGTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks