EMAIL THIS PAGE TO A FRIEND

TYRP1

tyrosinase-related protein 1

Synonyms: CAS2 CATB GP75 OCA3 TRP TRP1 TYRP b-PROTEIN
UniProtKB ID: P17643, P78468, P78469, Q13721, Q15679
Gene ID:
Human(7306) Summary: This gene encodes a melanosomal enzyme that belongs to the tyrosinase family and plays an important role in the melanin biosynthetic pathway. Defects in this gene are the cause of rufous oculocutaneous albinism and oculocutaneous albinism type III. [provided by RefSeq, Mar 2009]
Mouse(22178) tyrosinase-related protein 1
Rat(298182) tyrosinase-related protein 1
domestic guinea pig(100717475) tyrosinase-related protein 1
naked mole-rat(101704615) tyrosinase-related protein 1
Domestic Rabbit(100342170) tyrosinase-related protein 1
cow(282105) tyrosinase-related protein 1
sheep(100034666) tyrosinase-related protein 1
chicken(395913) tyrosinase-related protein 1
domestic cat(554339) tyrosinase-related protein 1
Horse(100033886) tyrosinase-related protein 1
dog(403479) tyrosinase-related protein 1
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1406566 Anti-TYRP1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA000937 Anti-TYRP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV44313 Anti-TYRP1 antibody produced in rabbit IgG fraction of antiserum human, rat, sheep, goat, horse, bovine, mouse, canine, pig, guinea pig, rabbit
western blot pricing
SAB2102617 Anti-TYRP1 antibody produced in rabbit affinity isolated antibody rabbit, zebrafish, mouse, pig, guinea pig, sheep, goat, canine, bovine, human, rat, horse
western blot pricing
SAB2106673 Anti-TYRP1 antibody produced in rabbit affinity isolated antibody rat, horse, human, guinea pig, goat, rabbit, sheep
ELISA, western blot pricing
SAB1411376 Anti-TYRP1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031202 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031202 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031202 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000550 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000550 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000550 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU043111 MISSION® esiRNA esiRNA human TYRP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000550 Rosetta Predictions human pricing
NM_001106664 Rosetta Predictions rat pricing
NM_031202 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000550 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098083 predicted 1591
2 SASI_Hs01_00098084 predicted 979
3 SASI_Hs01_00098085 predicted 1636
4 SASI_Hs01_00098086 predicted 468
5 SASI_Hs01_00098087 predicted 1291
6 SASI_Hs01_00098088 predicted 1803
7 SASI_Hs01_00098089 predicted 1844
8 SASI_Hs02_00302780 predicted 1803
9 SASI_Hs01_00098091 predicted 941
10 SASI_Hs02_00302781 predicted 1764
11 SASI_Hs01_00098082 predicted 652
12 SASI_Hs01_00098090 predicted 1060
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106664 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221168 predicted 543
2 SASI_Rn02_00221169 predicted 1487
3 SASI_Rn02_00221170 predicted 815
4 SASI_Rn02_00221171 predicted 1174
5 SASI_Rn02_00221172 predicted 1694
6 SASI_Rn02_00221173 predicted 1009
7 SASI_Rn02_00221174 predicted 1532
8 SASI_Rn02_00221175 predicted 1258
9 SASI_Rn02_00221176 predicted 250
10 SASI_Rn02_00221177 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031202 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161650 predicted 1652
2 SASI_Mm01_00161651 predicted 566
3 SASI_Mm01_00161652 predicted 1636
4 SASI_Mm01_00161653 predicted 836
5 SASI_Mm02_00337063 predicted 819
6 SASI_Mm01_00161655 predicted 1559
7 SASI_Mm01_00161657 predicted 1982
8 SASI_Mm01_00161658 predicted 1521
9 SASI_Mm02_00337064 predicted 1133
10 SASI_Mm01_00161659 predicted 1926
11 SASI_Mm01_00161654 predicted 815
12 SASI_Mm01_00161656 predicted 574
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031202
VALIDATED
TYRP1 MISSION shRNA Bacterial Glycerol Stock
tyrosinase-related protein 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031202.2-352s21c1
Sequence:CCGGCACGAGAGTGTGCCAATATTGCTCGAGCAATATTGGCACACTCTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031202.2-1939s21c1
Sequence:CCGGACACAGCTGTCAACCGTATTTCTCGAGAAATACGGTTGACAGCTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031202.2-809s21c1
Sequence:CCGGTGAGAACATTTCCGTTTATAACTCGAGTTATAAACGGAAATGTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114861    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031202.2-2259s1c1
Sequence:CCGGGCATTGTTATTGTTGGTACTACTCGAGTAGTACCAACAATAACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031202.2-1081s1c1
Sequence:CCGGGCAACTTCGATTCTACTCTTACTCGAGTAAGAGTAGAATCGAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031202.2-1139s1c1
Sequence:CCGGCTGTGAATCCTTGGAAGAGTACTCGAGTACTCTTCCAAGGATTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031202.2-1498s1c1
Sequence:CCGGCGGTCTTTGACGAATGGCTAACTCGAGTTAGCCATTCGTCAAAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031202.2-1532s1c1
Sequence:CCGGCGATATTTCTACCTTCCCGTTCTCGAGAACGGGAAGGTAGAAATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031202
VALIDATED
TYRP1 MISSION shRNA shRNA Plasmid DNA
tyrosinase-related protein 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031202.2-352s21c1
Sequence:CCGGCACGAGAGTGTGCCAATATTGCTCGAGCAATATTGGCACACTCTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031202.2-1939s21c1
Sequence:CCGGACACAGCTGTCAACCGTATTTCTCGAGAAATACGGTTGACAGCTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031202.2-809s21c1
Sequence:CCGGTGAGAACATTTCCGTTTATAACTCGAGTTATAAACGGAAATGTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114861    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031202.2-2259s1c1
Sequence:CCGGGCATTGTTATTGTTGGTACTACTCGAGTAGTACCAACAATAACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031202.2-1081s1c1
Sequence:CCGGGCAACTTCGATTCTACTCTTACTCGAGTAAGAGTAGAATCGAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031202.2-1139s1c1
Sequence:CCGGCTGTGAATCCTTGGAAGAGTACTCGAGTACTCTTCCAAGGATTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031202.2-1498s1c1
Sequence:CCGGCGGTCTTTGACGAATGGCTAACTCGAGTTAGCCATTCGTCAAAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031202.2-1532s1c1
Sequence:CCGGCGATATTTCTACCTTCCCGTTCTCGAGAACGGGAAGGTAGAAATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031202
VALIDATED
TYRP1 MISSION shRNA Lentiviral Transduction Particles
tyrosinase-related protein 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031202.2-352s21c1
Sequence:CCGGCACGAGAGTGTGCCAATATTGCTCGAGCAATATTGGCACACTCTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031202.2-1939s21c1
Sequence:CCGGACACAGCTGTCAACCGTATTTCTCGAGAAATACGGTTGACAGCTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031202.2-809s21c1
Sequence:CCGGTGAGAACATTTCCGTTTATAACTCGAGTTATAAACGGAAATGTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114861    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031202.2-2259s1c1
Sequence:CCGGGCATTGTTATTGTTGGTACTACTCGAGTAGTACCAACAATAACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031202.2-1081s1c1
Sequence:CCGGGCAACTTCGATTCTACTCTTACTCGAGTAAGAGTAGAATCGAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031202.2-1139s1c1
Sequence:CCGGCTGTGAATCCTTGGAAGAGTACTCGAGTACTCTTCCAAGGATTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031202.2-1498s1c1
Sequence:CCGGCGGTCTTTGACGAATGGCTAACTCGAGTTAGCCATTCGTCAAAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031202.2-1532s1c1
Sequence:CCGGCGATATTTCTACCTTCCCGTTCTCGAGAACGGGAAGGTAGAAATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000550
TYRP1 MISSION shRNA Bacterial Glycerol Stock
tyrosinase-related protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000550.2-1426s21c1
Sequence:CCGGGAGATACAATGCTGATATATCCTCGAGGATATATCAGCATTGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000550.2-634s21c1
Sequence:CCGGGCGCACAACTCACCCTTTATTCTCGAGAATAAAGGGTGAGTTGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000550.2-472s21c1
Sequence:CCGGATGTCACTGCAACGGCAATTTCTCGAGAAATTGCCGTTGCAGTGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000550.2-1356s21c1
Sequence:CCGGTGTCTCCAAATGATCCTATTTCTCGAGAAATAGGATCATTTGGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000550.1-924s1c1
Sequence:CCGGGCAACTTTGATTCCACTCTAACTCGAGTTAGAGTGGAATCAAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118672    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000550.1-2033s1c1
Sequence:CCGGCCATGCTTTGTTTACGTGTAACTCGAGTTACACGTAAACAAAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000550.1-1492s1c1
Sequence:CCGGCCTGGGATACACTTATGAAATCTCGAGATTTCATAAGTGTATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000550.1-640s1c1
Sequence:CCGGCACGCCACAATTTGAGAACATCTCGAGATGTTCTCAAATTGTGGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000550.1-642s1c1
Sequence:CCGGCGCCACAATTTGAGAACATTTCTCGAGAAATGTTCTCAAATTGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000550
TYRP1 MISSION shRNA shRNA Plasmid DNA
tyrosinase-related protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000550.2-1426s21c1
Sequence:CCGGGAGATACAATGCTGATATATCCTCGAGGATATATCAGCATTGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000550.2-634s21c1
Sequence:CCGGGCGCACAACTCACCCTTTATTCTCGAGAATAAAGGGTGAGTTGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000550.2-472s21c1
Sequence:CCGGATGTCACTGCAACGGCAATTTCTCGAGAAATTGCCGTTGCAGTGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000550.2-1356s21c1
Sequence:CCGGTGTCTCCAAATGATCCTATTTCTCGAGAAATAGGATCATTTGGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000550.1-924s1c1
Sequence:CCGGGCAACTTTGATTCCACTCTAACTCGAGTTAGAGTGGAATCAAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118672    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000550.1-2033s1c1
Sequence:CCGGCCATGCTTTGTTTACGTGTAACTCGAGTTACACGTAAACAAAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000550.1-1492s1c1
Sequence:CCGGCCTGGGATACACTTATGAAATCTCGAGATTTCATAAGTGTATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000550.1-640s1c1
Sequence:CCGGCACGCCACAATTTGAGAACATCTCGAGATGTTCTCAAATTGTGGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000550.1-642s1c1
Sequence:CCGGCGCCACAATTTGAGAACATTTCTCGAGAAATGTTCTCAAATTGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000550
TYRP1 MISSION shRNA Lentiviral Transduction Particles
tyrosinase-related protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000550.2-1426s21c1
Sequence:CCGGGAGATACAATGCTGATATATCCTCGAGGATATATCAGCATTGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000550.2-634s21c1
Sequence:CCGGGCGCACAACTCACCCTTTATTCTCGAGAATAAAGGGTGAGTTGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000550.2-472s21c1
Sequence:CCGGATGTCACTGCAACGGCAATTTCTCGAGAAATTGCCGTTGCAGTGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000550.2-1356s21c1
Sequence:CCGGTGTCTCCAAATGATCCTATTTCTCGAGAAATAGGATCATTTGGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000550.1-924s1c1
Sequence:CCGGGCAACTTTGATTCCACTCTAACTCGAGTTAGAGTGGAATCAAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118672    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000550.1-2033s1c1
Sequence:CCGGCCATGCTTTGTTTACGTGTAACTCGAGTTACACGTAAACAAAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000550.1-1492s1c1
Sequence:CCGGCCTGGGATACACTTATGAAATCTCGAGATTTCATAAGTGTATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000550.1-640s1c1
Sequence:CCGGCACGCCACAATTTGAGAACATCTCGAGATGTTCTCAAATTGTGGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000550.1-642s1c1
Sequence:CCGGCGCCACAATTTGAGAACATTTCTCGAGAAATGTTCTCAAATTGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks