EMAIL THIS PAGE TO A FRIEND

TYSND1

trypsin domain containing 1

Synonyms: NET41
UniProtKB ID: Q2T9J0, Q5SQT4, Q5SQU1, Q8N6H2, Q96AR5
Gene ID:
Human(219743) Summary: This gene encodes a protease that removes the N-terminal peroxisomal targeting signal (PTS2) from proteins produced in the cytosol, thereby facilitating their import into the peroxisome. The encoded protein is also capable of removing the C-terminal peroxisomal targeting signal (PTS1) from proteins in the peroxisomal matrix. The full-length protein undergoes self-cleavage to produce shorter, potentially inactive, peptides. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Jan 2013]
Mouse(71767) trypsin domain containing 1
Rat(365571) trypsin domain containing 1
Zebrafish(561667) trypsin domain containing 1
domestic cat(101098894) trypsin domain containing 1
Horse(100072712) trypsin domain containing 1
dog(100687512) trypsin domain containing 1
chicken(769373) trypsin domain containing 1
cow(101903772) trypsin domain containing 1
sheep(101109145) trypsin domain containing 1
naked mole-rat(101712356) trypsin domain containing 1
domestic guinea pig(100715057) trypsin domain containing 1
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_125636 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_125636 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_125636 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173555 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173555 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173555 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040273 Rosetta Predictions human pricing
NM_173555 Rosetta Predictions human pricing
NM_001108932 Rosetta Predictions rat pricing
XM_125636 Rosetta Predictions mouse pricing
XM_905996 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040273 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198269 predicted 1779
2 SASI_Hs01_00198270 predicted 1841
3 SASI_Hs01_00198271 predicted 1647
4 SASI_Hs01_00198272 predicted 1724
5 SASI_Hs01_00198273 predicted 1321
6 SASI_Hs02_00308922 predicted 1409
7 SASI_Hs02_00308923 predicted 1320
8 SASI_Hs01_00198274 predicted 359
9 SASI_Hs01_00198275 predicted 1325
10 SASI_Hs01_00198276 predicted 674
11 SASI_Hs01_00198277 predicted 804
12 SASI_Hs01_00198278 predicted 687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173555 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143170 predicted 2096
2 SASI_Hs01_00143171 predicted 2155
3 SASI_Hs01_00143172 predicted 2307
4 SASI_Hs01_00143174 predicted 1968
5 SASI_Hs01_00143175 predicted 2306
6 SASI_Hs01_00143176 predicted 2279
7 SASI_Hs01_00143177 predicted 2318
8 SASI_Hs01_00143178 predicted 2294
9 SASI_Hs01_00143179 predicted 2261
10 SASI_Hs02_00368368 predicted 1841
11 SASI_Hs01_00143173 predicted 1867
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108932 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243504 predicted 2004
2 SASI_Rn02_00243505 predicted 1538
3 SASI_Rn02_00243506 predicted 1627
4 SASI_Rn02_00243507 predicted 1946
5 SASI_Rn02_00243508 predicted 1893
6 SASI_Rn02_00243509 predicted 2023
7 SASI_Rn02_00243510 predicted 1822
8 SASI_Rn02_00243511 predicted 1331
9 SASI_Rn02_00243512 predicted 239
10 SASI_Rn02_00243513 predicted 1954
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_125636 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424096 predicted 522
2 SASI_Mm02_00424097 predicted 1359
3 SASI_Mm01_00224960 predicted 1632
4 SASI_Mm01_00224961 predicted 1774
5 SASI_Mm01_00224962 predicted 1381
6 SASI_Mm02_00424098 predicted 1264
7 SASI_Mm01_00224966 predicted 1634
8 SASI_Mm01_00224968 predicted 1197
9 SASI_Mm02_00424099 predicted 1511
10 SASI_Mm02_00424100 predicted 1438
11 SASI_Mm01_00224959 predicted 1914
12 SASI_Mm01_00224963 predicted 1908
13 SASI_Mm01_00224964 predicted 1557
14 SASI_Mm01_00224965 predicted 1260
15 SASI_Mm01_00224967 predicted 1274
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_905996 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00432256 predicted 521
2 SASI_Mm02_00432257 predicted 1913
3 SASI_Mm02_00432258 predicted 1630
4 SASI_Mm02_00432259 predicted 1778
5 SASI_Mm02_00432260 predicted 1377
6 SASI_Mm02_00432261 predicted 1905
7 SASI_Mm02_00432262 predicted 1261
8 SASI_Mm02_00432263 predicted 1637
9 SASI_Mm02_00432264 predicted 1269
10 SASI_Mm02_00432265 predicted 1195
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_125636
TYSND1 MISSION shRNA Bacterial Glycerol Stock
trypsin domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125636.1-1306s1c1
Sequence:CCGGGAAGAGGAGCTGAATGGTGTTCTCGAGAACACCATTCAGCTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125636.1-529s1c1
Sequence:CCGGGTCGATCAATGGCACTTCGTACTCGAGTACGAAGTGCCATTGATCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125636.1-738s1c1
Sequence:CCGGCGGTGCCTTCTGCCCGGACATCTCGAGATGTCCGGGCAGAAGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125636.1-1557s1c1
Sequence:CCGGCAGCAACACTCGAGACAACAACTCGAGTTGTTGTCTCGAGTGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125636.1-279s1c1
Sequence:CCGGCGACAGTTGCAGCGATGACCTCTCGAGAGGTCATCGCTGCAACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_125636
TYSND1 MISSION shRNA shRNA Plasmid DNA
trypsin domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125636.1-1306s1c1
Sequence:CCGGGAAGAGGAGCTGAATGGTGTTCTCGAGAACACCATTCAGCTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125636.1-529s1c1
Sequence:CCGGGTCGATCAATGGCACTTCGTACTCGAGTACGAAGTGCCATTGATCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125636.1-738s1c1
Sequence:CCGGCGGTGCCTTCTGCCCGGACATCTCGAGATGTCCGGGCAGAAGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125636.1-1557s1c1
Sequence:CCGGCAGCAACACTCGAGACAACAACTCGAGTTGTTGTCTCGAGTGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125636.1-279s1c1
Sequence:CCGGCGACAGTTGCAGCGATGACCTCTCGAGAGGTCATCGCTGCAACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_125636
TYSND1 MISSION shRNA Lentiviral Transduction Particles
trypsin domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125636.1-1306s1c1
Sequence:CCGGGAAGAGGAGCTGAATGGTGTTCTCGAGAACACCATTCAGCTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125636.1-529s1c1
Sequence:CCGGGTCGATCAATGGCACTTCGTACTCGAGTACGAAGTGCCATTGATCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125636.1-738s1c1
Sequence:CCGGCGGTGCCTTCTGCCCGGACATCTCGAGATGTCCGGGCAGAAGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125636.1-1557s1c1
Sequence:CCGGCAGCAACACTCGAGACAACAACTCGAGTTGTTGTCTCGAGTGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125636.1-279s1c1
Sequence:CCGGCGACAGTTGCAGCGATGACCTCTCGAGAGGTCATCGCTGCAACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173555
VALIDATED
TYSND1 MISSION shRNA Bacterial Glycerol Stock
trypsin domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166476    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173555.1-2291s1c1
Sequence:CCGGCAGAGACAGAAGGGACAGAAACTCGAGTTTCTGTCCCTTCTGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173555.1-788s1c1
Sequence:CCGGCGACATCTTTCTCAACACGCTCTCGAGAGCGTGTTGAGAAAGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173555.1-791s1c1
Sequence:CCGGCATCTTTCTCAACACGCTGAGCTCGAGCTCAGCGTGTTGAGAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173555.1-789s1c1
Sequence:CCGGGACATCTTTCTCAACACGCTGCTCGAGCAGCGTGTTGAGAAAGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173555.1-1798s1c1
Sequence:CCGGGCTGTGTTACCACCTTTGGAACTCGAGTTCCAAAGGTGGTAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173555.1-2269s1c1
Sequence:CCGGGCAGAAACCTTGCTCTGAAGACTCGAGTCTTCAGAGCAAGGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173555.1-1574s1c1
Sequence:CCGGCCTTGGCATAATCACCAGCAACTCGAGTTGCTGGTGATTATGCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173555.1-1550s1c1
Sequence:CCGGCTTCTCCAACCACTCAGGAAACTCGAGTTTCCTGAGTGGTTGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173555
VALIDATED
TYSND1 MISSION shRNA shRNA Plasmid DNA
trypsin domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166476    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173555.1-2291s1c1
Sequence:CCGGCAGAGACAGAAGGGACAGAAACTCGAGTTTCTGTCCCTTCTGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173555.1-788s1c1
Sequence:CCGGCGACATCTTTCTCAACACGCTCTCGAGAGCGTGTTGAGAAAGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173555.1-791s1c1
Sequence:CCGGCATCTTTCTCAACACGCTGAGCTCGAGCTCAGCGTGTTGAGAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173555.1-789s1c1
Sequence:CCGGGACATCTTTCTCAACACGCTGCTCGAGCAGCGTGTTGAGAAAGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173555.1-1798s1c1
Sequence:CCGGGCTGTGTTACCACCTTTGGAACTCGAGTTCCAAAGGTGGTAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173555.1-2269s1c1
Sequence:CCGGGCAGAAACCTTGCTCTGAAGACTCGAGTCTTCAGAGCAAGGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173555.1-1574s1c1
Sequence:CCGGCCTTGGCATAATCACCAGCAACTCGAGTTGCTGGTGATTATGCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173555.1-1550s1c1
Sequence:CCGGCTTCTCCAACCACTCAGGAAACTCGAGTTTCCTGAGTGGTTGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173555
VALIDATED
TYSND1 MISSION shRNA Lentiviral Transduction Particles
trypsin domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166476    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173555.1-2291s1c1
Sequence:CCGGCAGAGACAGAAGGGACAGAAACTCGAGTTTCTGTCCCTTCTGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173555.1-788s1c1
Sequence:CCGGCGACATCTTTCTCAACACGCTCTCGAGAGCGTGTTGAGAAAGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173555.1-791s1c1
Sequence:CCGGCATCTTTCTCAACACGCTGAGCTCGAGCTCAGCGTGTTGAGAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173555.1-789s1c1
Sequence:CCGGGACATCTTTCTCAACACGCTGCTCGAGCAGCGTGTTGAGAAAGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173555.1-1798s1c1
Sequence:CCGGGCTGTGTTACCACCTTTGGAACTCGAGTTCCAAAGGTGGTAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173555.1-2269s1c1
Sequence:CCGGGCAGAAACCTTGCTCTGAAGACTCGAGTCTTCAGAGCAAGGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173555.1-1574s1c1
Sequence:CCGGCCTTGGCATAATCACCAGCAACTCGAGTTGCTGGTGATTATGCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173555.1-1550s1c1
Sequence:CCGGCTTCTCCAACCACTCAGGAAACTCGAGTTTCCTGAGTGGTTGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks