EMAIL THIS PAGE TO A FRIEND

TYW1

tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)

Synonyms: RSAFD1 TYW1A YPL207W
Gene ID:
Human(55253) Summary: Wybutosine (yW) is a hypermodified guanosine found in phenylalanine tRNA adjacent to the anticodon that stabilizes codon-anticodon interactions in the ribosome. In yeast, the homolog of this gene is essential for the synthesis of wybutosine. [provided by RefSeq, Dec 2012]
Mouse(100929) tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
Rat(304423) tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
Zebrafish(562076) tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
Horse(100062082) tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
domestic cat(101083473) tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
dog(479708) tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
chicken(417478) tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
domestic guinea pig(100721498) tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
naked mole-rat(101713541) tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
Domestic Rabbit(100354908) tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
cow(533109) tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
sheep(101111335) tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178897 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178897 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178897 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018264 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018264 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018264 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU114241 MISSION® esiRNA esiRNA human AC092536.3-201 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018264 Rosetta Predictions human pricing
NM_001107137 Rosetta Predictions rat pricing
NM_001015876 Rosetta Predictions mouse pricing
NM_178897 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018264 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019182 predicted 1954
2 SASI_Hs01_00019183 predicted 503
3 SASI_Hs01_00019184 predicted 1501
4 SASI_Hs01_00019186 predicted 1722
5 SASI_Hs01_00019187 predicted 1574
6 SASI_Hs01_00019188 predicted 910
7 SASI_Hs01_00019189 predicted 248
8 SASI_Hs02_00351631 predicted 1584
9 SASI_Hs01_00019190 predicted 550
10 SASI_Hs02_00351632 predicted 1680
11 SASI_Hs01_00019185 predicted 674
12 SASI_Hs01_00019191 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107137 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225865 predicted 2213
2 SASI_Rn02_00225866 predicted 2292
3 SASI_Rn02_00225867 predicted 1426
4 SASI_Rn02_00225868 predicted 637
5 SASI_Rn02_00225869 predicted 757
6 SASI_Rn02_00225870 predicted 506
7 SASI_Rn02_00225871 predicted 619
8 SASI_Rn02_00225872 predicted 451
9 SASI_Rn02_00225873 predicted 1462
10 SASI_Rn02_00225874 predicted 1278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015876 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047614 predicted 392
2 SASI_Mm01_00047615 predicted 540
3 SASI_Mm01_00047616 predicted 478
4 SASI_Mm01_00047617 predicted 673
5 SASI_Mm01_00047618 predicted 500
6 SASI_Mm01_00047619 predicted 580
7 SASI_Mm01_00047620 predicted 495
8 SASI_Mm01_00047622 predicted 797
9 SASI_Mm02_00287462 predicted 787
10 SASI_Mm01_00047623 predicted 302
11 SASI_Mm01_00047621 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178897 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153960 predicted 353
2 SASI_Mm01_00153961 predicted 509
3 SASI_Mm01_00153962 predicted 445
4 SASI_Mm01_00153964 predicted 463
5 SASI_Mm01_00153965 predicted 538
6 SASI_Mm01_00153966 predicted 457
7 SASI_Mm02_00349495 predicted 908
8 SASI_Mm01_00153968 predicted 756
9 SASI_Mm02_00349496 predicted 752
10 SASI_Mm01_00153969 predicted 265
11 SASI_Mm01_00153963 predicted 641
12 SASI_Mm01_00153967 predicted 572
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178897
VALIDATED
TYW1 MISSION shRNA Bacterial Glycerol Stock
tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178897.2-1250s1c1
Sequence:CCGGCCTACAGGATTTGGTTCTCTTCTCGAGAAGAGAACCAAATCCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178897.2-349s1c1
Sequence:CCGGGATCCAGATGACAGTCTGATACTCGAGTATCAGACTGTCATCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178897.2-1133s1c1
Sequence:CCGGGCAGGTGGACAAAGGTATTTACTCGAGTAAATACCTTTGTCCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178897.2-1040s1c1
Sequence:CCGGGCGAAGGAAGAGCTATGATAACTCGAGTTATCATAGCTCTTCCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178897.2-325s1c1
Sequence:CCGGGCCATTATTAATCTGAAGGAACTCGAGTTCCTTCAGATTAATAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178897.2-69s1c1
Sequence:CCGGGTGGATGAACAGGTTCTACATCTCGAGATGTAGAACCTGTTCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178897.2-445s1c1
Sequence:CCGGGAGTGGTTCTGCAAGTGGTTACTCGAGTAACCACTTGCAGAACCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198922    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178897.2-2085s1c1
Sequence:CCGGGCTTCCCAAATGCTGGGATTACTCGAGTAATCCCAGCATTTGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216449    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178897.3-2507s1c1
Sequence:CCGGGTGTTTCATCCAACCTATAATCTCGAGATTATAGGTTGGATGAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178897
VALIDATED
TYW1 MISSION shRNA shRNA Plasmid DNA
tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178897.2-1250s1c1
Sequence:CCGGCCTACAGGATTTGGTTCTCTTCTCGAGAAGAGAACCAAATCCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178897.2-349s1c1
Sequence:CCGGGATCCAGATGACAGTCTGATACTCGAGTATCAGACTGTCATCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178897.2-1133s1c1
Sequence:CCGGGCAGGTGGACAAAGGTATTTACTCGAGTAAATACCTTTGTCCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178897.2-1040s1c1
Sequence:CCGGGCGAAGGAAGAGCTATGATAACTCGAGTTATCATAGCTCTTCCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178897.2-325s1c1
Sequence:CCGGGCCATTATTAATCTGAAGGAACTCGAGTTCCTTCAGATTAATAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178897.2-69s1c1
Sequence:CCGGGTGGATGAACAGGTTCTACATCTCGAGATGTAGAACCTGTTCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178897.2-445s1c1
Sequence:CCGGGAGTGGTTCTGCAAGTGGTTACTCGAGTAACCACTTGCAGAACCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198922    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178897.2-2085s1c1
Sequence:CCGGGCTTCCCAAATGCTGGGATTACTCGAGTAATCCCAGCATTTGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216449    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178897.3-2507s1c1
Sequence:CCGGGTGTTTCATCCAACCTATAATCTCGAGATTATAGGTTGGATGAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178897
VALIDATED
TYW1 MISSION shRNA Lentiviral Transduction Particles
tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178897.2-1250s1c1
Sequence:CCGGCCTACAGGATTTGGTTCTCTTCTCGAGAAGAGAACCAAATCCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178897.2-349s1c1
Sequence:CCGGGATCCAGATGACAGTCTGATACTCGAGTATCAGACTGTCATCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178897.2-1133s1c1
Sequence:CCGGGCAGGTGGACAAAGGTATTTACTCGAGTAAATACCTTTGTCCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178897.2-1040s1c1
Sequence:CCGGGCGAAGGAAGAGCTATGATAACTCGAGTTATCATAGCTCTTCCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178897.2-325s1c1
Sequence:CCGGGCCATTATTAATCTGAAGGAACTCGAGTTCCTTCAGATTAATAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178897.2-69s1c1
Sequence:CCGGGTGGATGAACAGGTTCTACATCTCGAGATGTAGAACCTGTTCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178897.2-445s1c1
Sequence:CCGGGAGTGGTTCTGCAAGTGGTTACTCGAGTAACCACTTGCAGAACCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198922    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178897.2-2085s1c1
Sequence:CCGGGCTTCCCAAATGCTGGGATTACTCGAGTAATCCCAGCATTTGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216449    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178897.3-2507s1c1
Sequence:CCGGGTGTTTCATCCAACCTATAATCTCGAGATTATAGGTTGGATGAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018264
VALIDATED
TYW1 MISSION shRNA Bacterial Glycerol Stock
tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018264.1-2097s1c1
Sequence:CCGGCCTCCTGATAGCACACAGAAACTCGAGTTTCTGTGTGCTATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018264.1-409s1c1
Sequence:CCGGGCAAAGGGATTCGCAACAGTTCTCGAGAACTGTTGCGAATCCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018264.1-345s1c1
Sequence:CCGGCCTTCAAGAGAAAGACATCTTCTCGAGAAGATGTCTTTCTCTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018264.1-2056s1c1
Sequence:CCGGCCCGAATATGAAATTGCATGTCTCGAGACATGCAATTTCATATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018264.1-274s1c1
Sequence:CCGGCAGGGCAAGAACTTACAGGAACTCGAGTTCCTGTAAGTTCTTGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018264.2-329s21c1
Sequence:CCGGTTTGATGACAAATGGTTATGTCTCGAGACATAACCATTTGTCATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_018264.2-1810s21c1
Sequence:CCGGAGAGATTCCTTGACAGTTTAACTCGAGTTAAACTGTCAAGGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_018264.2-2105s21c1
Sequence:CCGGCCTCCTGATAGCACACAGAAACTCGAGTTTCTGTGTGCTATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_018264.2-979s21c1
Sequence:CCGGAGCAGGATGAATTGCATCATACTCGAGTATGATGCAATTCATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018264.2-1237s21c1
Sequence:CCGGCCCTTACTAAACAAGGTTATCCTCGAGGATAACCTTGTTTAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018264
VALIDATED
TYW1 MISSION shRNA shRNA Plasmid DNA
tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018264.1-2097s1c1
Sequence:CCGGCCTCCTGATAGCACACAGAAACTCGAGTTTCTGTGTGCTATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018264.1-409s1c1
Sequence:CCGGGCAAAGGGATTCGCAACAGTTCTCGAGAACTGTTGCGAATCCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018264.1-345s1c1
Sequence:CCGGCCTTCAAGAGAAAGACATCTTCTCGAGAAGATGTCTTTCTCTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018264.1-2056s1c1
Sequence:CCGGCCCGAATATGAAATTGCATGTCTCGAGACATGCAATTTCATATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018264.1-274s1c1
Sequence:CCGGCAGGGCAAGAACTTACAGGAACTCGAGTTCCTGTAAGTTCTTGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018264.2-329s21c1
Sequence:CCGGTTTGATGACAAATGGTTATGTCTCGAGACATAACCATTTGTCATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_018264.2-1810s21c1
Sequence:CCGGAGAGATTCCTTGACAGTTTAACTCGAGTTAAACTGTCAAGGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_018264.2-2105s21c1
Sequence:CCGGCCTCCTGATAGCACACAGAAACTCGAGTTTCTGTGTGCTATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_018264.2-979s21c1
Sequence:CCGGAGCAGGATGAATTGCATCATACTCGAGTATGATGCAATTCATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018264.2-1237s21c1
Sequence:CCGGCCCTTACTAAACAAGGTTATCCTCGAGGATAACCTTGTTTAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018264
VALIDATED
TYW1 MISSION shRNA Lentiviral Transduction Particles
tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018264.1-2097s1c1
Sequence:CCGGCCTCCTGATAGCACACAGAAACTCGAGTTTCTGTGTGCTATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018264.1-409s1c1
Sequence:CCGGGCAAAGGGATTCGCAACAGTTCTCGAGAACTGTTGCGAATCCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018264.1-345s1c1
Sequence:CCGGCCTTCAAGAGAAAGACATCTTCTCGAGAAGATGTCTTTCTCTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018264.1-2056s1c1
Sequence:CCGGCCCGAATATGAAATTGCATGTCTCGAGACATGCAATTTCATATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018264.1-274s1c1
Sequence:CCGGCAGGGCAAGAACTTACAGGAACTCGAGTTCCTGTAAGTTCTTGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018264.2-329s21c1
Sequence:CCGGTTTGATGACAAATGGTTATGTCTCGAGACATAACCATTTGTCATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_018264.2-1810s21c1
Sequence:CCGGAGAGATTCCTTGACAGTTTAACTCGAGTTAAACTGTCAAGGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_018264.2-2105s21c1
Sequence:CCGGCCTCCTGATAGCACACAGAAACTCGAGTTTCTGTGTGCTATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_018264.2-979s21c1
Sequence:CCGGAGCAGGATGAATTGCATCATACTCGAGTATGATGCAATTCATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018264.2-1237s21c1
Sequence:CCGGCCCTTACTAAACAAGGTTATCCTCGAGGATAACCTTGTTTAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks