EMAIL THIS PAGE TO A FRIEND

TYW1B

tRNA-yW synthesizing protein 1 homolog B (S. cerevisiae)

Synonyms: LINC00069 NCRNA00069 RSAFD2
Species: Human TYW1B(441250)
UniProtKB ID: Q6NUM6, A6NG09, Q3KQX2
Gene ID:
Human(441250) Summary: Wybutosine (yW) is a hypermodified guanosine found in phenylalanine tRNA adjacent to the anticodon that stabilizes codon-anticodon interactions in the ribosome. In yeast, the homolog of this gene is essential for the synthesis of wybutosine (yW). The human genome contains two closely related genes that putatively function in wybutosine synthesis. The open reading frame of this locus is disrupted in some individuals. Thus, this locus appears to be an evolving pseudogene, but may still be functional in some members of the population. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145441 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145441 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145441 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_927345 Rosetta Predictions human pricing
XM_932006 Rosetta Predictions human pricing
XM_932016 Rosetta Predictions human pricing
XM_932018 Rosetta Predictions human pricing
XR_015176 Rosetta Predictions human pricing
XR_015229 Rosetta Predictions human pricing
XR_041925 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927345 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289373 predicted 1151
2 SASI_Hs01_00289374 predicted 1564
3 SASI_Hs01_00289375 predicted 1599
4 SASI_Hs01_00289376 predicted 1275
5 SASI_Hs01_00289377 predicted 1569
6 SASI_Hs01_00289378 predicted 1435
7 SASI_Hs01_00289379 predicted 1050
8 SASI_Hs01_00289380 predicted 1275
9 SASI_Hs01_00289381 predicted 1233
10 SASI_Hs01_00289382 predicted 1418
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932006 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278122 predicted 914
2 SASI_Hs01_00278123 predicted 1336
3 SASI_Hs01_00278124 predicted 1358
4 SASI_Hs01_00278125 predicted 1049
5 SASI_Hs01_00278126 predicted 1333
6 SASI_Hs01_00278127 predicted 1191
7 SASI_Hs01_00278128 predicted 815
8 SASI_Hs01_00278129 predicted 1042
9 SASI_Hs01_00278130 predicted 996
10 SASI_Hs01_00278131 predicted 1184
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932016 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00253097 predicted 983
2 SASI_Hs01_00253098 predicted 1080
3 SASI_Hs01_00253099 predicted 1403
4 SASI_Hs01_00253100 predicted 1113
5 SASI_Hs01_00253101 predicted 1074
6 SASI_Hs01_00253102 predicted 1370
7 SASI_Hs01_00253103 predicted 1425
8 SASI_Hs01_00253104 predicted 1401
9 SASI_Hs01_00253105 predicted 1055
10 SASI_Hs01_00253106 predicted 1304
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932018 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00280689 predicted 2253
2 SASI_Hs01_00280690 predicted 2674
3 SASI_Hs01_00280691 predicted 2697
4 SASI_Hs01_00280692 predicted 2384
5 SASI_Hs01_00280693 predicted 2676
6 SASI_Hs01_00280694 predicted 2537
7 SASI_Hs01_00280695 predicted 2145
8 SASI_Hs01_00280696 predicted 2372
9 SASI_Hs01_00280697 predicted 2337
10 SASI_Hs01_00280698 predicted 2521
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_015176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00487346 predicted 373
2 SASI_Hs02_00487347 predicted 1370
3 SASI_Hs02_00487348 predicted 1581
4 SASI_Hs02_00487349 predicted 2619
5 SASI_Hs02_00487350 predicted 1436
6 SASI_Hs02_00487351 predicted 524
7 SASI_Hs02_00487352 predicted 2730
8 SASI_Hs02_00487353 predicted 2330
9 SASI_Hs02_00487354 predicted 425
10 SASI_Hs02_00487355 predicted 1860
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_015229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00487499 predicted 375
2 SASI_Hs02_00487500 predicted 1373
3 SASI_Hs02_00487501 predicted 1590
4 SASI_Hs02_00487502 predicted 2617
5 SASI_Hs02_00487503 predicted 1434
6 SASI_Hs02_00487504 predicted 527
7 SASI_Hs02_00487505 predicted 2730
8 SASI_Hs02_00487506 predicted 2331
9 SASI_Hs02_00487507 predicted 419
10 SASI_Hs02_00487508 predicted 1859
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00531555 predicted 528
2 SASI_Hs02_00531556 predicted 1521
3 SASI_Hs02_00531557 predicted 1741
4 SASI_Hs02_00531558 predicted 2765
5 SASI_Hs02_00531559 predicted 1590
6 SASI_Hs02_00531560 predicted 674
7 SASI_Hs02_00531561 predicted 2879
8 SASI_Hs02_00531562 predicted 2475
9 SASI_Hs02_00531563 predicted 578
10 SASI_Hs02_00531564 predicted 2007
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145441
TYW1B MISSION shRNA Bacterial Glycerol Stock
tRNA-yW synthesizing protein 1 homolog B (S. cerevisiae)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145441.1-443s21c1
Sequence:CCGGAGGACCATCAGAGCCTAAATTCTCGAGAATTTAGGCTCTGATGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145441.1-718s21c1
Sequence:CCGGAGCTTGGCGTGTGCTAATAAACTCGAGTTTATTAGCACACGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145441.1-1142s21c1
Sequence:CCGGAGCAATTCCTTGACAGTTTAACTCGAGTTAAACTGTCAAGGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145441.1-613s21c1
Sequence:CCGGCTCCGAGAAGCCCTTACTAAACTCGAGTTTAGTAAGGGCTTCTCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145441.1-280s21c1
Sequence:CCGGGTCATCGAGATGCAGGGATTTCTCGAGAAATCCCTGCATCTCGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145441
TYW1B MISSION shRNA shRNA Plasmid DNA
tRNA-yW synthesizing protein 1 homolog B (S. cerevisiae)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145441.1-443s21c1
Sequence:CCGGAGGACCATCAGAGCCTAAATTCTCGAGAATTTAGGCTCTGATGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145441.1-718s21c1
Sequence:CCGGAGCTTGGCGTGTGCTAATAAACTCGAGTTTATTAGCACACGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145441.1-1142s21c1
Sequence:CCGGAGCAATTCCTTGACAGTTTAACTCGAGTTAAACTGTCAAGGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145441.1-613s21c1
Sequence:CCGGCTCCGAGAAGCCCTTACTAAACTCGAGTTTAGTAAGGGCTTCTCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145441.1-280s21c1
Sequence:CCGGGTCATCGAGATGCAGGGATTTCTCGAGAAATCCCTGCATCTCGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145441
TYW1B MISSION shRNA Lentiviral Transduction Particles
tRNA-yW synthesizing protein 1 homolog B (S. cerevisiae)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145441.1-443s21c1
Sequence:CCGGAGGACCATCAGAGCCTAAATTCTCGAGAATTTAGGCTCTGATGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145441.1-718s21c1
Sequence:CCGGAGCTTGGCGTGTGCTAATAAACTCGAGTTTATTAGCACACGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145441.1-1142s21c1
Sequence:CCGGAGCAATTCCTTGACAGTTTAACTCGAGTTAAACTGTCAAGGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145441.1-613s21c1
Sequence:CCGGCTCCGAGAAGCCCTTACTAAACTCGAGTTTAGTAAGGGCTTCTCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145441.1-280s21c1
Sequence:CCGGGTCATCGAGATGCAGGGATTTCTCGAGAAATCCCTGCATCTCGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks