EMAIL THIS PAGE TO A FRIEND

TYW3

tRNA-yW synthesizing protein 3 homolog (S. cerevisiae)

Synonyms: C1orf171
UniProtKB ID: Q6IPR3, B4DSP9, E9PGR7, Q5HYJ0, Q8N7L1
Gene ID:
Human(127253) Summary: Wybutosine (yW) is a hypermodified guanosine at the 3-prime position adjacent to the anticodon of phenylalanine tRNA that stabilizes codon-anticodon interactions during decoding on the ribosome. TYW3 is the human homolog of a yeast gene essential for yW synthesis (Noma and Suzuki, 2006).[supplied by OMIM, Mar 2008]
Mouse(209584) tRNA-yW synthesizing protein 3 homolog (S. cerevisiae)
Rat(499731) tRNA-yW synthesizing protein 3 homolog (S. cerevisiae)
Zebrafish(436884) tRNA-yW synthesizing protein 3 homolog (S. cerevisiae)
domestic cat(101086328) tRNA-yW synthesizing protein 3 homolog (S. cerevisiae)
dog(479986) tRNA-yW synthesizing protein 3 homolog (S. cerevisiae)
chicken(424720) tRNA-yW synthesizing protein 3 homolog (S. cerevisiae)
cow(519731) tRNA-yW synthesizing protein 3 homolog (S. cerevisiae)
sheep(101107062) tRNA-yW synthesizing protein 3 homolog (S. cerevisiae)
naked mole-rat(101713190) tRNA-yW synthesizing protein 3 homolog (S. cerevisiae)
domestic guinea pig(100716313) tRNA-yW synthesizing protein 3 homolog (S. cerevisiae)
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172474 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172474 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172474 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138467 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138467 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138467 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138467 Rosetta Predictions human pricing
XM_001080203 Rosetta Predictions rat pricing
XM_575065 Rosetta Predictions rat pricing
NM_172474 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138467 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018515 predicted 429
2 SASI_Hs02_00363654 predicted 293
3 SASI_Hs02_00363655 predicted 292
4 SASI_Hs01_00018522 predicted 307
5 SASI_Hs02_00363656 predicted 441
6 SASI_Hs02_00363657 predicted 336
7 SASI_Hs02_00363658 predicted 293
8 SASI_Hs02_00363659 predicted 408
9 SASI_Hs02_00363660 predicted 422
10 SASI_Hs02_00363661 predicted 419
11 SASI_Hs01_00018514 predicted 366
12 SASI_Hs01_00018516 predicted 1070
13 SASI_Hs01_00018517 predicted 1046
14 SASI_Hs01_00018518 predicted 364
15 SASI_Hs01_00018519 predicted 390
16 SASI_Hs01_00018520 predicted 1076
17 SASI_Hs01_00018521 predicted 348
18 SASI_Hs01_00018523 predicted 1054
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080203 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367038 predicted 711
2 SASI_Rn02_00367039 predicted 748
3 SASI_Rn02_00367040 predicted 362
4 SASI_Rn02_00367041 predicted 552
5 SASI_Rn02_00367042 predicted 853
6 SASI_Rn02_00367043 predicted 629
7 SASI_Rn02_00367044 predicted 625
8 SASI_Rn02_00367045 predicted 562
9 SASI_Rn02_00367046 predicted 401
10 SASI_Rn02_00367047 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575065 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403000 predicted 712
2 SASI_Rn02_00403001 predicted 754
3 SASI_Rn02_00403002 predicted 362
4 SASI_Rn02_00403003 predicted 556
5 SASI_Rn02_00403004 predicted 848
6 SASI_Rn02_00403005 predicted 633
7 SASI_Rn02_00403006 predicted 627
8 SASI_Rn02_00403007 predicted 560
9 SASI_Rn02_00403008 predicted 401
10 SASI_Rn02_00403009 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172474 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200280 predicted 701
2 SASI_Mm01_00200281 predicted 641
3 SASI_Mm01_00200282 predicted 1069
4 SASI_Mm01_00200283 predicted 1053
5 SASI_Mm01_00200284 predicted 864
6 SASI_Mm01_00200285 predicted 1040
7 SASI_Mm01_00200286 predicted 573
8 SASI_Mm01_00200287 predicted 517
9 SASI_Mm01_00200288 predicted 1021
10 SASI_Mm01_00200289 predicted 427
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172474
VALIDATED
TYW3 MISSION shRNA Bacterial Glycerol Stock
tRNA-yW synthesizing protein 3 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172474.4-677s21c1
Sequence:CCGGACTCACATTCCAAGATCAAAGCTCGAGCTTTGATCTTGGAATGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172474.4-569s21c1
Sequence:CCGGTTGAGTTCCTGTTAACTATAGCTCGAGCTATAGTTAACAGGAACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172474.4-423s21c1
Sequence:CCGGGCACTCAGTGGCAATTGATTCCTCGAGGAATCAATTGCCACTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172474.4-648s21c1
Sequence:CCGGACATGCTCTCAAACGAGAAACCTCGAGGTTTCTCGTTTGAGAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172474.4-1868s21c1
Sequence:CCGGATCTCATCAAATCGAGTAAATCTCGAGATTTACTCGATTTGATGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197896    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172474.1-922s1c1
Sequence:CCGGGCAAGAGTTAATTTCTCTGTTCTCGAGAACAGAGAAATTAACTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172474.1-499s1c1
Sequence:CCGGCATGGATTGGAAGTCCCATTACTCGAGTAATGGGACTTCCAATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172474.1-652s1c1
Sequence:CCGGGAAACCATTTCAAACTCACATCTCGAGATGTGAGTTTGAAATGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172474
VALIDATED
TYW3 MISSION shRNA shRNA Plasmid DNA
tRNA-yW synthesizing protein 3 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172474.4-677s21c1
Sequence:CCGGACTCACATTCCAAGATCAAAGCTCGAGCTTTGATCTTGGAATGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172474.4-569s21c1
Sequence:CCGGTTGAGTTCCTGTTAACTATAGCTCGAGCTATAGTTAACAGGAACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172474.4-423s21c1
Sequence:CCGGGCACTCAGTGGCAATTGATTCCTCGAGGAATCAATTGCCACTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172474.4-648s21c1
Sequence:CCGGACATGCTCTCAAACGAGAAACCTCGAGGTTTCTCGTTTGAGAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172474.4-1868s21c1
Sequence:CCGGATCTCATCAAATCGAGTAAATCTCGAGATTTACTCGATTTGATGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197896    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172474.1-922s1c1
Sequence:CCGGGCAAGAGTTAATTTCTCTGTTCTCGAGAACAGAGAAATTAACTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172474.1-499s1c1
Sequence:CCGGCATGGATTGGAAGTCCCATTACTCGAGTAATGGGACTTCCAATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172474.1-652s1c1
Sequence:CCGGGAAACCATTTCAAACTCACATCTCGAGATGTGAGTTTGAAATGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172474
VALIDATED
TYW3 MISSION shRNA Lentiviral Transduction Particles
tRNA-yW synthesizing protein 3 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172474.4-677s21c1
Sequence:CCGGACTCACATTCCAAGATCAAAGCTCGAGCTTTGATCTTGGAATGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172474.4-569s21c1
Sequence:CCGGTTGAGTTCCTGTTAACTATAGCTCGAGCTATAGTTAACAGGAACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172474.4-423s21c1
Sequence:CCGGGCACTCAGTGGCAATTGATTCCTCGAGGAATCAATTGCCACTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172474.4-648s21c1
Sequence:CCGGACATGCTCTCAAACGAGAAACCTCGAGGTTTCTCGTTTGAGAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172474.4-1868s21c1
Sequence:CCGGATCTCATCAAATCGAGTAAATCTCGAGATTTACTCGATTTGATGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197896    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172474.1-922s1c1
Sequence:CCGGGCAAGAGTTAATTTCTCTGTTCTCGAGAACAGAGAAATTAACTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172474.1-499s1c1
Sequence:CCGGCATGGATTGGAAGTCCCATTACTCGAGTAATGGGACTTCCAATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172474.1-652s1c1
Sequence:CCGGGAAACCATTTCAAACTCACATCTCGAGATGTGAGTTTGAAATGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138467
VALIDATED
TYW3 MISSION shRNA Bacterial Glycerol Stock
tRNA-yW synthesizing protein 3 homolog (S. cerevisiae)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138467.1-125s1c1
Sequence:CCGGGCAATGTTTGAGCAAAGCGGACTCGAGTCCGCTTTGCTCAAACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138467.1-119s1c1
Sequence:CCGGGAAGGCGCAATGTTTGAGCAACTCGAGTTGCTCAAACATTGCGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138467.1-688s1c1
Sequence:CCGGCGATGACTAACTTACATCCCACTCGAGTGGGATGTAAGTTAGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138467.1-354s1c1
Sequence:CCGGCTGAAGAAAGCAAATGGTGATCTCGAGATCACCATTTGCTTTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134381    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138467.1-1756s1c1
Sequence:CCGGGCTGCATATCAGAATTACCTACTCGAGTAGGTAATTCTGATATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_138467.1-921s1c1
Sequence:CCGGGCTGCTCTTCATAAGAGTATTCTCGAGAATACTCTTATGAAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_138467.1-689s1c1
Sequence:CCGGGATGACTAACTTACATCCCAACTCGAGTTGGGATGTAAGTTAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_138467.1-893s1c1
Sequence:CCGGCCGTAATGTTTCTAGTAGGTTCTCGAGAACCTACTAGAAACATTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138467.1-596s1c1
Sequence:CCGGCCTGTTAAATGTGGCAAATCACTCGAGTGATTTGCCACATTTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_138467.1-448s1c1
Sequence:CCGGCCATGGCAATAGATTCTGGTTCTCGAGAACCAGAATCTATTGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_138467.1-771s1c1
Sequence:CCGGCGTGCCCAGTGTATTACTAAACTCGAGTTTAGTAATACACTGGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138467
VALIDATED
TYW3 MISSION shRNA shRNA Plasmid DNA
tRNA-yW synthesizing protein 3 homolog (S. cerevisiae)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138467.1-125s1c1
Sequence:CCGGGCAATGTTTGAGCAAAGCGGACTCGAGTCCGCTTTGCTCAAACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138467.1-119s1c1
Sequence:CCGGGAAGGCGCAATGTTTGAGCAACTCGAGTTGCTCAAACATTGCGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138467.1-688s1c1
Sequence:CCGGCGATGACTAACTTACATCCCACTCGAGTGGGATGTAAGTTAGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138467.1-354s1c1
Sequence:CCGGCTGAAGAAAGCAAATGGTGATCTCGAGATCACCATTTGCTTTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134381    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138467.1-1756s1c1
Sequence:CCGGGCTGCATATCAGAATTACCTACTCGAGTAGGTAATTCTGATATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_138467.1-921s1c1
Sequence:CCGGGCTGCTCTTCATAAGAGTATTCTCGAGAATACTCTTATGAAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_138467.1-689s1c1
Sequence:CCGGGATGACTAACTTACATCCCAACTCGAGTTGGGATGTAAGTTAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_138467.1-893s1c1
Sequence:CCGGCCGTAATGTTTCTAGTAGGTTCTCGAGAACCTACTAGAAACATTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138467.1-596s1c1
Sequence:CCGGCCTGTTAAATGTGGCAAATCACTCGAGTGATTTGCCACATTTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_138467.1-448s1c1
Sequence:CCGGCCATGGCAATAGATTCTGGTTCTCGAGAACCAGAATCTATTGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_138467.1-771s1c1
Sequence:CCGGCGTGCCCAGTGTATTACTAAACTCGAGTTTAGTAATACACTGGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138467
VALIDATED
TYW3 MISSION shRNA Lentiviral Transduction Particles
tRNA-yW synthesizing protein 3 homolog (S. cerevisiae)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138467.1-125s1c1
Sequence:CCGGGCAATGTTTGAGCAAAGCGGACTCGAGTCCGCTTTGCTCAAACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138467.1-119s1c1
Sequence:CCGGGAAGGCGCAATGTTTGAGCAACTCGAGTTGCTCAAACATTGCGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138467.1-688s1c1
Sequence:CCGGCGATGACTAACTTACATCCCACTCGAGTGGGATGTAAGTTAGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138467.1-354s1c1
Sequence:CCGGCTGAAGAAAGCAAATGGTGATCTCGAGATCACCATTTGCTTTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134381    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138467.1-1756s1c1
Sequence:CCGGGCTGCATATCAGAATTACCTACTCGAGTAGGTAATTCTGATATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_138467.1-921s1c1
Sequence:CCGGGCTGCTCTTCATAAGAGTATTCTCGAGAATACTCTTATGAAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_138467.1-689s1c1
Sequence:CCGGGATGACTAACTTACATCCCAACTCGAGTTGGGATGTAAGTTAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_138467.1-893s1c1
Sequence:CCGGCCGTAATGTTTCTAGTAGGTTCTCGAGAACCTACTAGAAACATTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138467.1-596s1c1
Sequence:CCGGCCTGTTAAATGTGGCAAATCACTCGAGTGATTTGCCACATTTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_138467.1-448s1c1
Sequence:CCGGCCATGGCAATAGATTCTGGTTCTCGAGAACCAGAATCTATTGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_138467.1-771s1c1
Sequence:CCGGCGTGCCCAGTGTATTACTAAACTCGAGTTTAGTAATACACTGGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks