EMAIL THIS PAGE TO A FRIEND

TYW5

tRNA-yW synthesizing protein 5

Synonyms: C2orf60 hTYW5
UniProtKB ID: A2RUC4, B2RNE3, Q8N1R2
Gene ID:
Mouse(68736) tRNA-yW synthesizing protein 5
Rat(301419) tRNA-yW synthesizing protein 5
domestic guinea pig(100714448) tRNA-yW synthesizing protein 5
naked mole-rat(101696883) tRNA-yW synthesizing protein 5
cow(539498) tRNA-yW synthesizing protein 5
sheep(101103128) tRNA-yW synthesizing protein 5
Zebrafish(557725) tRNA-yW synthesizing protein 5
domestic cat(101090635) tRNA-yW synthesizing protein 5
dog(478861) tRNA-yW synthesizing protein 5
chicken(424065) tRNA-yW synthesizing protein 5
167 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152382 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152382 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152382 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039693 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039693 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039693 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001037742 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001037742 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001037742 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039693 Rosetta Predictions human pricing
NR_004862 Rosetta Predictions human pricing
XM_001067847 Rosetta Predictions rat pricing
XM_217397 Rosetta Predictions rat pricing
NM_001037742 Rosetta Predictions mouse pricing
NM_001114102 Rosetta Predictions mouse pricing
NR_004860 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190227 predicted 1073
2 SASI_Hs02_00308639 predicted 345
3 SASI_Hs01_00190228 predicted 945
4 SASI_Hs01_00190229 predicted 608
5 SASI_Hs01_00190230 predicted 739
6 SASI_Hs01_00190231 predicted 435
7 SASI_Hs02_00308640 predicted 378
8 SASI_Hs01_00190232 predicted 1143
9 SASI_Hs01_00190233 predicted 618
10 SASI_Hs01_00190234 predicted 842
11 SASI_Hs01_00190235 predicted 665
12 SASI_Hs01_00190236 predicted 828
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_004862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381042 predicted 1052
2 SASI_Hs02_00381043 predicted 457
3 SASI_Hs02_00381044 predicted 926
4 SASI_Hs02_00381045 predicted 587
5 SASI_Hs02_00381046 predicted 723
6 SASI_Hs02_00381047 predicted 436
7 SASI_Hs02_00381048 predicted 384
8 SASI_Hs02_00381049 predicted 1122
9 SASI_Hs02_00381050 predicted 597
10 SASI_Hs02_00381051 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067847 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00322533 predicted 270
2 SASI_Rn02_00322534 predicted 368
3 SASI_Rn02_00322535 predicted 641
4 SASI_Rn02_00322536 predicted 473
5 SASI_Rn02_00322537 predicted 640
6 SASI_Rn02_00322538 predicted 467
7 SASI_Rn02_00322539 predicted 329
8 SASI_Rn02_00322540 predicted 308
9 SASI_Rn02_00322541 predicted 264
10 SASI_Rn02_00322542 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217397 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377144 predicted 274
2 SASI_Rn02_00377145 predicted 369
3 SASI_Rn02_00377146 predicted 636
4 SASI_Rn02_00377147 predicted 467
5 SASI_Rn02_00377148 predicted 638
6 SASI_Rn02_00377149 predicted 469
7 SASI_Rn02_00377150 predicted 325
8 SASI_Rn02_00377151 predicted 303
9 SASI_Rn02_00377152 predicted 260
10 SASI_Rn02_00377153 predicted 672
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037742 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165418 predicted 728
2 SASI_Mm02_00289390 predicted 545
3 SASI_Mm02_00289391 predicted 310
4 SASI_Mm02_00289392 predicted 331
5 SASI_Mm02_00289393 predicted 431
6 SASI_Mm02_00289394 predicted 411
7 SASI_Mm02_00289395 predicted 502
8 SASI_Mm02_00289396 predicted 595
9 SASI_Mm01_00165422 predicted 892
10 SASI_Mm02_00289397 predicted 519
11 SASI_Mm01_00165419 predicted 480
12 SASI_Mm01_00165420 predicted 648
13 SASI_Mm01_00165421 predicted 584
14 SASI_Mm01_00165423 predicted 473
15 SASI_Mm01_00165424 predicted 599
16 SASI_Mm01_00165425 predicted 647
17 SASI_Mm01_00165426 predicted 468
18 SASI_Mm01_00165427 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114102 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308389 predicted 402
2 SASI_Mm02_00308390 predicted 306
3 SASI_Mm02_00308391 predicted 342
4 SASI_Mm02_00308392 predicted 454
5 SASI_Mm02_00308393 predicted 329
6 SASI_Mm02_00308394 predicted 454
7 SASI_Mm02_00308395 predicted 405
8 SASI_Mm02_00308396 predicted 400
9 SASI_Mm02_00308397 predicted 483
10 SASI_Mm02_00308398 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_004860 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00354282 predicted 401
2 SASI_Mm02_00354283 predicted 707
3 SASI_Mm02_00354284 predicted 526
4 SASI_Mm02_00354285 predicted 317
5 SASI_Mm02_00354286 predicted 331
6 SASI_Mm02_00354287 predicted 582
7 SASI_Mm02_00354288 predicted 670
8 SASI_Mm02_00354289 predicted 874
9 SASI_Mm02_00354290 predicted 576
10 SASI_Mm02_00354291 predicted 498
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152382
TYW5 MISSION shRNA Bacterial Glycerol Stock
tRNA-yW synthesizing protein 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167830    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152382.1-2110s1c1
Sequence:CCGGGCAATCTCTTAGTACATCAATCTCGAGATTGATGTACTAAGAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152382.1-2178s1c1
Sequence:CCGGCCATCCACTCATGTCCTATAACTCGAGTTATAGGACATGAGTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152382.1-476s1c1
Sequence:CCGGGATAACCCAGACTTGGCTAAACTCGAGTTTAGCCAAGTCTGGGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152382.1-735s1c1
Sequence:CCGGCCGAGTTACCAGAGGAATATACTCGAGTATATTCCTCTGGTAACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152382.1-2058s1c1
Sequence:CCGGGTGTCATTGAAGACCACATAACTCGAGTTATGTGGTCTTCAATGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152382
TYW5 MISSION shRNA shRNA Plasmid DNA
tRNA-yW synthesizing protein 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167830    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152382.1-2110s1c1
Sequence:CCGGGCAATCTCTTAGTACATCAATCTCGAGATTGATGTACTAAGAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152382.1-2178s1c1
Sequence:CCGGCCATCCACTCATGTCCTATAACTCGAGTTATAGGACATGAGTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152382.1-476s1c1
Sequence:CCGGGATAACCCAGACTTGGCTAAACTCGAGTTTAGCCAAGTCTGGGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152382.1-735s1c1
Sequence:CCGGCCGAGTTACCAGAGGAATATACTCGAGTATATTCCTCTGGTAACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152382.1-2058s1c1
Sequence:CCGGGTGTCATTGAAGACCACATAACTCGAGTTATGTGGTCTTCAATGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152382
TYW5 MISSION shRNA Lentiviral Transduction Particles
tRNA-yW synthesizing protein 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167830    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152382.1-2110s1c1
Sequence:CCGGGCAATCTCTTAGTACATCAATCTCGAGATTGATGTACTAAGAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152382.1-2178s1c1
Sequence:CCGGCCATCCACTCATGTCCTATAACTCGAGTTATAGGACATGAGTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152382.1-476s1c1
Sequence:CCGGGATAACCCAGACTTGGCTAAACTCGAGTTTAGCCAAGTCTGGGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152382.1-735s1c1
Sequence:CCGGCCGAGTTACCAGAGGAATATACTCGAGTATATTCCTCTGGTAACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152382.1-2058s1c1
Sequence:CCGGGTGTCATTGAAGACCACATAACTCGAGTTATGTGGTCTTCAATGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039693
VALIDATED
TYW5 MISSION shRNA Bacterial Glycerol Stock
tRNA-yW synthesizing protein 5
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039693.2-737s21c1
Sequence:CCGGATGGACTCATTATGATGTAATCTCGAGATTACATCATAATGAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039693.2-1197s21c1
Sequence:CCGGAGCAAGAACTCTGAGTAAATACTCGAGTATTTACTCAGAGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039693.2-1126s21c1
Sequence:CCGGCCGAGTTACCAGAGGAATATACTCGAGTATATTCCTCTGGTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039693.2-867s21c1
Sequence:CCGGGATAACCCAGACTTGGCTAAACTCGAGTTTAGCCAAGTCTGGGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039693.2-1229s21c1
Sequence:CCGGGCAATGCACATTAACACTTTACTCGAGTAAAGTGTTAATGTGCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039693.2-1512s21c1
Sequence:CCGGCTGATCCAATGATTCAGTAATCTCGAGATTACTGAATCATTGGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039693
VALIDATED
TYW5 MISSION shRNA shRNA Plasmid DNA
tRNA-yW synthesizing protein 5
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039693.2-737s21c1
Sequence:CCGGATGGACTCATTATGATGTAATCTCGAGATTACATCATAATGAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039693.2-1197s21c1
Sequence:CCGGAGCAAGAACTCTGAGTAAATACTCGAGTATTTACTCAGAGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039693.2-1126s21c1
Sequence:CCGGCCGAGTTACCAGAGGAATATACTCGAGTATATTCCTCTGGTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039693.2-867s21c1
Sequence:CCGGGATAACCCAGACTTGGCTAAACTCGAGTTTAGCCAAGTCTGGGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039693.2-1229s21c1
Sequence:CCGGGCAATGCACATTAACACTTTACTCGAGTAAAGTGTTAATGTGCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039693.2-1512s21c1
Sequence:CCGGCTGATCCAATGATTCAGTAATCTCGAGATTACTGAATCATTGGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039693
VALIDATED
TYW5 MISSION shRNA Lentiviral Transduction Particles
tRNA-yW synthesizing protein 5
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039693.2-737s21c1
Sequence:CCGGATGGACTCATTATGATGTAATCTCGAGATTACATCATAATGAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039693.2-1197s21c1
Sequence:CCGGAGCAAGAACTCTGAGTAAATACTCGAGTATTTACTCAGAGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039693.2-1126s21c1
Sequence:CCGGCCGAGTTACCAGAGGAATATACTCGAGTATATTCCTCTGGTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039693.2-867s21c1
Sequence:CCGGGATAACCCAGACTTGGCTAAACTCGAGTTTAGCCAAGTCTGGGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039693.2-1229s21c1
Sequence:CCGGGCAATGCACATTAACACTTTACTCGAGTAAAGTGTTAATGTGCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039693.2-1512s21c1
Sequence:CCGGCTGATCCAATGATTCAGTAATCTCGAGATTACTGAATCATTGGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037742
VALIDATED
TYW5 MISSION shRNA Bacterial Glycerol Stock
tRNA-yW synthesizing protein 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037742.2-726s21c1
Sequence:CCGGGACAGGAAAGAAGCGAATTACCTCGAGGTAATTCGCTTCTTTCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037742.2-1268s21c1
Sequence:CCGGAGATAAGTCTGAGATTTATAGCTCGAGCTATAAATCTCAGACTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037742.2-1095s21c1
Sequence:CCGGGGACTTCTATGCACGCCAAATCTCGAGATTTGGCGTGCATAGAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037742.2-305s21c1
Sequence:CCGGTGTTGGAAGGACTCGACTTAGCTCGAGCTAAGTCGAGTCCTTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037742.2-755s21c1
Sequence:CCGGATCCTCGGGATGCACAATATTCTCGAGAATATTGTGCATCCCGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037742
VALIDATED
TYW5 MISSION shRNA shRNA Plasmid DNA
tRNA-yW synthesizing protein 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037742.2-726s21c1
Sequence:CCGGGACAGGAAAGAAGCGAATTACCTCGAGGTAATTCGCTTCTTTCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037742.2-1268s21c1
Sequence:CCGGAGATAAGTCTGAGATTTATAGCTCGAGCTATAAATCTCAGACTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037742.2-1095s21c1
Sequence:CCGGGGACTTCTATGCACGCCAAATCTCGAGATTTGGCGTGCATAGAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037742.2-305s21c1
Sequence:CCGGTGTTGGAAGGACTCGACTTAGCTCGAGCTAAGTCGAGTCCTTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037742.2-755s21c1
Sequence:CCGGATCCTCGGGATGCACAATATTCTCGAGAATATTGTGCATCCCGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037742
VALIDATED
TYW5 MISSION shRNA Lentiviral Transduction Particles
tRNA-yW synthesizing protein 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037742.2-726s21c1
Sequence:CCGGGACAGGAAAGAAGCGAATTACCTCGAGGTAATTCGCTTCTTTCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037742.2-1268s21c1
Sequence:CCGGAGATAAGTCTGAGATTTATAGCTCGAGCTATAAATCTCAGACTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037742.2-1095s21c1
Sequence:CCGGGGACTTCTATGCACGCCAAATCTCGAGATTTGGCGTGCATAGAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037742.2-305s21c1
Sequence:CCGGTGTTGGAAGGACTCGACTTAGCTCGAGCTAAGTCGAGTCCTTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037742.2-755s21c1
Sequence:CCGGATCCTCGGGATGCACAATATTCTCGAGAATATTGTGCATCCCGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks