EMAIL THIS PAGE TO A FRIEND

U2AF1

U2 small nuclear RNA auxiliary factor 1

Synonyms: FP793 RN RNU2AF1 U2AF35 U2AFBP
UniProtKB ID: Q01081, Q701P4, Q71RF1
Gene ID:
Human(7307) Summary: This gene belongs to the splicing factor SR family of genes. U2 auxiliary factor, comprising a large and a small subunit, is a non-snRNP protein required for the binding of U2 snRNP to the pre-mRNA branch site. This gene encodes the small subunit which plays a critical role in both constitutive and enhancer-dependent RNA splicing by directly mediating interactions between the large subunit and proteins bound to the enhancers. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(108121) U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 1
Rat(687575) U2 small nuclear RNA auxiliary factor 1
Zebrafish(192328) U2(RNU2) small nuclear RNA auxiliary factor 1
chicken(395370) U2 small nuclear RNA auxiliary factor 1
dog(478422) U2 small nuclear RNA auxiliary factor 1
domestic cat(101084133) U2 small nuclear RNA auxiliary factor 1
cow(512680) U2 small nuclear RNA auxiliary factor 1
sheep(101122249) U2 small nuclear RNA auxiliary factor 1
naked mole-rat(101702719) U2 small nuclear RNA auxiliary factor 1
domestic guinea pig(100723513) U2 small nuclear RNA auxiliary factor 1
141 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006758 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006758 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006758 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024187 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024187 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024187 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025203 Rosetta Predictions human pricing
NM_001025204 Rosetta Predictions human pricing
NM_006758 Rosetta Predictions human pricing
NM_001044291 Rosetta Predictions rat pricing
NM_024187 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025203 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307410 predicted 764
2 SASI_Hs01_00113578 predicted 197
3 SASI_Hs02_00307411 predicted 772
4 SASI_Hs01_00113579 predicted 110
5 SASI_Hs01_00113580 predicted 831
6 SASI_Hs01_00113581 predicted 791
7 SASI_Hs01_00113582 predicted 285
8 SASI_Hs01_00113583 predicted 412
9 SASI_Hs01_00113584 predicted 275
10 SASI_Hs01_00113586 predicted 822
11 SASI_Hs01_00113577 predicted 175
12 SASI_Hs01_00113585 predicted 297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307412 predicted 834
2 SASI_Hs02_00307413 predicted 841
3 SASI_Hs01_00239582 predicted 893
4 SASI_Hs01_00239583 predicted 865
5 SASI_Hs01_00239584 predicted 863
6 SASI_Hs01_00239585 predicted 476
7 SASI_Hs01_00239586 predicted 493
8 SASI_Hs01_00239587 predicted 881
9 SASI_Hs02_00307414 predicted 726
10 SASI_Hs01_00239588 predicted 901
11 SASI_Hs01_00239589 predicted 913
12 SASI_Hs01_00239590 predicted 378
13 SASI_Hs01_00239591 predicted 865
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006758 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342243 predicted 764
2 SASI_Hs01_00010031 predicted 177
3 SASI_Hs02_00342244 predicted 769
4 SASI_Hs01_00010032 predicted 114
5 SASI_Hs01_00010033 predicted 827
6 SASI_Hs01_00010034 predicted 792
7 SASI_Hs01_00010035 predicted 284
8 SASI_Hs01_00010036 predicted 411
9 SASI_Hs01_00010039 predicted 816
10 SASI_Hs02_00342245 predicted 656
11 SASI_Hs01_00010037 predicted 427
12 SASI_Hs01_00010038 predicted 295
13 SASI_Hs01_00010040 predicted 833
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044291 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205584 predicted 192
2 SASI_Rn02_00205585 predicted 496
3 SASI_Rn02_00205586 predicted 448
4 SASI_Rn02_00205587 predicted 336
5 SASI_Rn02_00205588 predicted 558
6 SASI_Rn02_00205589 predicted 343
7 SASI_Rn02_00205590 predicted 278
8 SASI_Rn02_00205591 predicted 415
9 SASI_Rn02_00205592 predicted 560
10 SASI_Rn02_00205593 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024187 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098243 predicted 531
2 SASI_Mm01_00098244 predicted 346
3 SASI_Mm01_00098245 predicted 483
4 SASI_Mm02_00327517 predicted 396
5 SASI_Mm01_00098246 predicted 246
6 SASI_Mm01_00098247 predicted 392
7 SASI_Mm01_00098248 predicted 310
8 SASI_Mm02_00327518 predicted 538
9 SASI_Mm01_00098249 predicted 469
10 SASI_Mm02_00327519 predicted 231
11 SASI_Mm01_00098250 predicted 393
12 SASI_Mm01_00098251 predicted 539
13 SASI_Mm01_00098252 predicted 378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006758
VALIDATED
U2AF1 MISSION shRNA Bacterial Glycerol Stock
U2 small nuclear RNA auxiliary factor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006758.2-301s21c1
Sequence:CCGGGAGATGCAGGAACACTATGATCTCGAGATCATAGTGTTCCTGCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006758.2-473s21c1
Sequence:CCGGTGAATAACCGTTGGTTTAATGCTCGAGCATTAAACCAACGGTTATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006758.2-837s21c1
Sequence:CCGGGAAAGTGTTGTAGTTGATTGACTCGAGTCAATCAACTACAACACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006758.2-202s21c1
Sequence:CCGGCCGACGTTTAGCCAGACCATTCTCGAGAATGGTCTGGCTAAACGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006758.x-791s1c1
Sequence:CCGGGAAAGTGTTGTAGTTGATTGACTCGAGTCAATCAACTACAACACTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006758.x-255s1c1
Sequence:CCGGGAGATGCAGGAACACTATGATCTCGAGATCATAGTGTTCCTGCATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006758.x-436s1c1
Sequence:CCGGGTTGGTTTAATGGACAGCCGACTCGAGTCGGCTGTCCATTAAACCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006758.x-603s1c1
Sequence:CCGGCGTCGCAAGAAGCATAGATCACTCGAGTGATCTATGCTTCTTGCGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006758.x-156s1c1
Sequence:CCGGCCGACGTTTAGCCAGACCATTCTCGAGAATGGTCTGGCTAAACGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006758
VALIDATED
U2AF1 MISSION shRNA shRNA Plasmid DNA
U2 small nuclear RNA auxiliary factor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006758.2-301s21c1
Sequence:CCGGGAGATGCAGGAACACTATGATCTCGAGATCATAGTGTTCCTGCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006758.2-473s21c1
Sequence:CCGGTGAATAACCGTTGGTTTAATGCTCGAGCATTAAACCAACGGTTATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006758.2-837s21c1
Sequence:CCGGGAAAGTGTTGTAGTTGATTGACTCGAGTCAATCAACTACAACACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006758.2-202s21c1
Sequence:CCGGCCGACGTTTAGCCAGACCATTCTCGAGAATGGTCTGGCTAAACGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006758.x-791s1c1
Sequence:CCGGGAAAGTGTTGTAGTTGATTGACTCGAGTCAATCAACTACAACACTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006758.x-255s1c1
Sequence:CCGGGAGATGCAGGAACACTATGATCTCGAGATCATAGTGTTCCTGCATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006758.x-436s1c1
Sequence:CCGGGTTGGTTTAATGGACAGCCGACTCGAGTCGGCTGTCCATTAAACCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006758.x-603s1c1
Sequence:CCGGCGTCGCAAGAAGCATAGATCACTCGAGTGATCTATGCTTCTTGCGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006758.x-156s1c1
Sequence:CCGGCCGACGTTTAGCCAGACCATTCTCGAGAATGGTCTGGCTAAACGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006758
VALIDATED
U2AF1 MISSION shRNA Lentiviral Transduction Particles
U2 small nuclear RNA auxiliary factor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006758.2-301s21c1
Sequence:CCGGGAGATGCAGGAACACTATGATCTCGAGATCATAGTGTTCCTGCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006758.2-473s21c1
Sequence:CCGGTGAATAACCGTTGGTTTAATGCTCGAGCATTAAACCAACGGTTATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006758.2-837s21c1
Sequence:CCGGGAAAGTGTTGTAGTTGATTGACTCGAGTCAATCAACTACAACACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006758.2-202s21c1
Sequence:CCGGCCGACGTTTAGCCAGACCATTCTCGAGAATGGTCTGGCTAAACGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006758.x-791s1c1
Sequence:CCGGGAAAGTGTTGTAGTTGATTGACTCGAGTCAATCAACTACAACACTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006758.x-255s1c1
Sequence:CCGGGAGATGCAGGAACACTATGATCTCGAGATCATAGTGTTCCTGCATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006758.x-436s1c1
Sequence:CCGGGTTGGTTTAATGGACAGCCGACTCGAGTCGGCTGTCCATTAAACCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006758.x-603s1c1
Sequence:CCGGCGTCGCAAGAAGCATAGATCACTCGAGTGATCTATGCTTCTTGCGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006758.x-156s1c1
Sequence:CCGGCCGACGTTTAGCCAGACCATTCTCGAGAATGGTCTGGCTAAACGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024187
VALIDATED
U2AF1 MISSION shRNA Bacterial Glycerol Stock
U2 small nuclear RNA auxiliary factor 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024187.3-158s21c1
Sequence:CCGGGCCCTCTTGAACATTTACCGTCTCGAGACGGTAAATGTTCAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024187.3-137s21c1
Sequence:CCGGCCAACCTTTAGCCAGACCATTCTCGAGAATGGTCTGGCTAAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024187.3-403s21c1
Sequence:CCGGCGACTTGAATAACCGTTGGTTCTCGAGAACCAACGGTTATTCAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024187.3-455s21c1
Sequence:CCGGCCAGTAACTGACTTCAGGGAACTCGAGTTCCCTGAAGTCAGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024187.2-161s1c1
Sequence:CCGGCCTCTTGAACATTTACCGTAACTCGAGTTACGGTAAATGTTCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024187.2-404s1c1
Sequence:CCGGCGACTTGAATAACCGTTGGTTCTCGAGAACCAACGGTTATTCAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024187.2-138s1c1
Sequence:CCGGCCAACCTTTAGCCAGACCATTCTCGAGAATGGTCTGGCTAAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024187.2-456s1c1
Sequence:CCGGCCAGTAACTGACTTCAGGGAACTCGAGTTCCCTGAAGTCAGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024187.2-159s1c1
Sequence:CCGGGCCCTCTTGAACATTTACCGTCTCGAGACGGTAAATGTTCAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024187
VALIDATED
U2AF1 MISSION shRNA shRNA Plasmid DNA
U2 small nuclear RNA auxiliary factor 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024187.3-158s21c1
Sequence:CCGGGCCCTCTTGAACATTTACCGTCTCGAGACGGTAAATGTTCAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024187.3-137s21c1
Sequence:CCGGCCAACCTTTAGCCAGACCATTCTCGAGAATGGTCTGGCTAAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024187.3-403s21c1
Sequence:CCGGCGACTTGAATAACCGTTGGTTCTCGAGAACCAACGGTTATTCAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024187.3-455s21c1
Sequence:CCGGCCAGTAACTGACTTCAGGGAACTCGAGTTCCCTGAAGTCAGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024187.2-161s1c1
Sequence:CCGGCCTCTTGAACATTTACCGTAACTCGAGTTACGGTAAATGTTCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024187.2-404s1c1
Sequence:CCGGCGACTTGAATAACCGTTGGTTCTCGAGAACCAACGGTTATTCAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024187.2-138s1c1
Sequence:CCGGCCAACCTTTAGCCAGACCATTCTCGAGAATGGTCTGGCTAAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024187.2-456s1c1
Sequence:CCGGCCAGTAACTGACTTCAGGGAACTCGAGTTCCCTGAAGTCAGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024187.2-159s1c1
Sequence:CCGGGCCCTCTTGAACATTTACCGTCTCGAGACGGTAAATGTTCAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024187
VALIDATED
U2AF1 MISSION shRNA Lentiviral Transduction Particles
U2 small nuclear RNA auxiliary factor 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024187.3-158s21c1
Sequence:CCGGGCCCTCTTGAACATTTACCGTCTCGAGACGGTAAATGTTCAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024187.3-137s21c1
Sequence:CCGGCCAACCTTTAGCCAGACCATTCTCGAGAATGGTCTGGCTAAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024187.3-403s21c1
Sequence:CCGGCGACTTGAATAACCGTTGGTTCTCGAGAACCAACGGTTATTCAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024187.3-455s21c1
Sequence:CCGGCCAGTAACTGACTTCAGGGAACTCGAGTTCCCTGAAGTCAGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024187.2-161s1c1
Sequence:CCGGCCTCTTGAACATTTACCGTAACTCGAGTTACGGTAAATGTTCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024187.2-404s1c1
Sequence:CCGGCGACTTGAATAACCGTTGGTTCTCGAGAACCAACGGTTATTCAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024187.2-138s1c1
Sequence:CCGGCCAACCTTTAGCCAGACCATTCTCGAGAATGGTCTGGCTAAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024187.2-456s1c1
Sequence:CCGGCCAGTAACTGACTTCAGGGAACTCGAGTTCCCTGAAGTCAGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024187.2-159s1c1
Sequence:CCGGGCCCTCTTGAACATTTACCGTCTCGAGACGGTAAATGTTCAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks