EMAIL THIS PAGE TO A FRIEND

U2AF1L4

U2 small nuclear RNA auxiliary factor 1-like 4

Synonyms: U2AF1-RS3 U2AF1L3 U2AF1L3V1 U2AF1RS3 U2af26
UniProtKB ID: Q8WU68, A6NKI8, Q56UU3
Gene ID:
Mouse(233073) U2 small nuclear RNA auxiliary factor 1-like 4
Rat(361542) U2 small nuclear RNA auxiliary factor 1-like 4
naked mole-rat(101720600) U2 small nuclear RNA auxiliary factor 1-like 4
cow(615198) U2 small nuclear RNA auxiliary factor 1-like 4
sheep(101120185) U2 small nuclear RNA auxiliary factor 1-like 4
dog(476480) U2 small nuclear RNA auxiliary factor 1-like 4
domestic cat(101100016) U2 small nuclear RNA auxiliary factor 1-like 4
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_170760 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_170760 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_170760 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144987 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144987 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144987 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU124391 MISSION® esiRNA esiRNA human U2AF1L4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040425 Rosetta Predictions human pricing
NM_144987 Rosetta Predictions human pricing
NM_001008775 Rosetta Predictions rat pricing
NM_170760 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233946 predicted 378
2 SASI_Hs01_00233948 predicted 216
3 SASI_Hs01_00233949 predicted 374
4 SASI_Hs01_00233950 predicted 358
5 SASI_Hs01_00233951 predicted 409
6 SASI_Hs01_00233953 predicted 219
7 SASI_Hs01_00233954 predicted 207
8 SASI_Hs01_00233955 predicted 322
9 SASI_Hs02_00308952 predicted 379
10 SASI_Hs02_00308953 predicted 253
11 SASI_Hs01_00233947 predicted 385
12 SASI_Hs01_00233952 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144987 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035686 predicted 293
2 SASI_Hs01_00035687 predicted 357
3 SASI_Hs01_00035688 predicted 217
4 SASI_Hs01_00035689 predicted 300
5 SASI_Hs01_00035690 predicted 296
6 SASI_Hs01_00035691 predicted 288
7 SASI_Hs01_00035692 predicted 295
8 SASI_Hs01_00035693 predicted 241
9 SASI_Hs01_00035694 predicted 250
10 SASI_Hs01_00035695 predicted 294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008775 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082650 predicted 322
2 SASI_Rn01_00082652 predicted 419
3 SASI_Rn01_00082653 predicted 476
4 SASI_Rn01_00082654 predicted 226
5 SASI_Rn01_00082655 predicted 332
6 SASI_Rn01_00082656 predicted 463
7 SASI_Rn01_00082657 predicted 280
8 SASI_Rn01_00082658 predicted 433
9 SASI_Rn01_00082659 predicted 449
10 SASI_Rn02_00199293 predicted 361
11 SASI_Rn01_00082651 predicted 370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170760 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035496 predicted 539
2 SASI_Mm01_00035497 predicted 397
3 SASI_Mm02_00343627 predicted 448
4 SASI_Mm01_00035498 predicted 235
5 SASI_Mm01_00035499 predicted 233
6 SASI_Mm01_00035500 predicted 231
7 SASI_Mm01_00035501 predicted 527
8 SASI_Mm01_00035502 predicted 408
9 SASI_Mm02_00343628 predicted 204
10 SASI_Mm01_00035504 predicted 284
11 SASI_Mm01_00035503 predicted 346
12 SASI_Mm01_00035505 predicted 260
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170760
VALIDATED
U2AF1L4 MISSION shRNA Bacterial Glycerol Stock
U2 small nuclear RNA auxiliary factor 1-like 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_170760.2-238s1c1
Sequence:CCGGGCAAGAACACTATGATAACTTCTCGAGAAGTTATCATAGTGTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_170760.2-121s1c1
Sequence:CCGGACTTCACAACAAACCGACTTTCTCGAGAAAGTCGGTTTGTTGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170760.2-585s1c1
Sequence:CCGGCCAGGCATAGGTCACCTCCAACTCGAGTTGGAGGTGACCTATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170760.2-343s1c1
Sequence:CCGGCGTGGGCAATGTCTACGTTAACTCGAGTTAACGTAGACATTGCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170760.2-158s1c1
Sequence:CCGGCTGCTCAACTTGTACCGGAATCTCGAGATTCCGGTACAAGTTGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_170760.3-122s21c1
Sequence:CCGGCTTCACAACAAACCGACTTTCCTCGAGGAAAGTCGGTTTGTTGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_170760.3-528s21c1
Sequence:CCGGTTATGCACCTACGGCCCATATCTCGAGATATGGGCCGTAGGTGCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_170760.3-235s21c1
Sequence:CCGGGGTGCAAGAACACTATGATAACTCGAGTTATCATAGTGTTCTTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_170760.3-692s21c1
Sequence:CCGGTGCTCTCCACCCAAGGGCATACTCGAGTATGCCCTTGGGTGGAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_170760.3-344s21c1
Sequence:CCGGGTGGGCAATGTCTACGTTAAGCTCGAGCTTAACGTAGACATTGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170760
VALIDATED
U2AF1L4 MISSION shRNA shRNA Plasmid DNA
U2 small nuclear RNA auxiliary factor 1-like 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_170760.2-238s1c1
Sequence:CCGGGCAAGAACACTATGATAACTTCTCGAGAAGTTATCATAGTGTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_170760.2-121s1c1
Sequence:CCGGACTTCACAACAAACCGACTTTCTCGAGAAAGTCGGTTTGTTGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170760.2-585s1c1
Sequence:CCGGCCAGGCATAGGTCACCTCCAACTCGAGTTGGAGGTGACCTATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170760.2-343s1c1
Sequence:CCGGCGTGGGCAATGTCTACGTTAACTCGAGTTAACGTAGACATTGCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170760.2-158s1c1
Sequence:CCGGCTGCTCAACTTGTACCGGAATCTCGAGATTCCGGTACAAGTTGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_170760.3-122s21c1
Sequence:CCGGCTTCACAACAAACCGACTTTCCTCGAGGAAAGTCGGTTTGTTGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_170760.3-528s21c1
Sequence:CCGGTTATGCACCTACGGCCCATATCTCGAGATATGGGCCGTAGGTGCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_170760.3-235s21c1
Sequence:CCGGGGTGCAAGAACACTATGATAACTCGAGTTATCATAGTGTTCTTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_170760.3-692s21c1
Sequence:CCGGTGCTCTCCACCCAAGGGCATACTCGAGTATGCCCTTGGGTGGAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_170760.3-344s21c1
Sequence:CCGGGTGGGCAATGTCTACGTTAAGCTCGAGCTTAACGTAGACATTGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170760
VALIDATED
U2AF1L4 MISSION shRNA Lentiviral Transduction Particles
U2 small nuclear RNA auxiliary factor 1-like 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_170760.2-238s1c1
Sequence:CCGGGCAAGAACACTATGATAACTTCTCGAGAAGTTATCATAGTGTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_170760.2-121s1c1
Sequence:CCGGACTTCACAACAAACCGACTTTCTCGAGAAAGTCGGTTTGTTGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170760.2-585s1c1
Sequence:CCGGCCAGGCATAGGTCACCTCCAACTCGAGTTGGAGGTGACCTATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170760.2-343s1c1
Sequence:CCGGCGTGGGCAATGTCTACGTTAACTCGAGTTAACGTAGACATTGCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170760.2-158s1c1
Sequence:CCGGCTGCTCAACTTGTACCGGAATCTCGAGATTCCGGTACAAGTTGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_170760.3-122s21c1
Sequence:CCGGCTTCACAACAAACCGACTTTCCTCGAGGAAAGTCGGTTTGTTGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_170760.3-528s21c1
Sequence:CCGGTTATGCACCTACGGCCCATATCTCGAGATATGGGCCGTAGGTGCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_170760.3-235s21c1
Sequence:CCGGGGTGCAAGAACACTATGATAACTCGAGTTATCATAGTGTTCTTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_170760.3-692s21c1
Sequence:CCGGTGCTCTCCACCCAAGGGCATACTCGAGTATGCCCTTGGGTGGAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_170760.3-344s21c1
Sequence:CCGGGTGGGCAATGTCTACGTTAAGCTCGAGCTTAACGTAGACATTGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144987
VALIDATED
U2AF1L4 MISSION shRNA Bacterial Glycerol Stock
U2 small nuclear RNA auxiliary factor 1-like 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_144987.1-125s1c1
Sequence:CCGGGCTTCACAACAAGCCGACATTCTCGAGAATGTCGGCTTGTTGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_144987.1-287s1c1
Sequence:CCGGTGAACTCAGTAACCGCTGGTTCTCGAGAACCAGCGGTTACTGAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_144987.1-194s1c1
Sequence:CCGGAGAGATGAATGTGTGCGACAACTCGAGTTGTCGCACACATTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_144987.1-458s1c1
Sequence:CCGGCGAGAGAGGAACCATCGGTGTCTCGAGACACCGATGGTTCCTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_144987.1-230s1c1
Sequence:CCGGCGTGGGCAACGTCTATGTCAACTCGAGTTGACATAGACGTTGCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144987.2-579s21c1
Sequence:CCGGTGGCAGGACCTCTCCTCAAAGCTCGAGCTTTGAGGAGAGGTCCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144987.2-458s21c1
Sequence:CCGGAGGTTCCATACTGGCCACCATCTCGAGATGGTGGCCAGTATGGAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144987.2-267s21c1
Sequence:CCGGTATGTCAAGTTCCGGAGGGAGCTCGAGCTCCCTCCGGAACTTGACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144987.2-79s21c1
Sequence:CCGGAGAAGGACAAGGTTAACTGCTCTCGAGAGCAGTTAACCTTGTCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144987
VALIDATED
U2AF1L4 MISSION shRNA shRNA Plasmid DNA
U2 small nuclear RNA auxiliary factor 1-like 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_144987.1-125s1c1
Sequence:CCGGGCTTCACAACAAGCCGACATTCTCGAGAATGTCGGCTTGTTGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_144987.1-287s1c1
Sequence:CCGGTGAACTCAGTAACCGCTGGTTCTCGAGAACCAGCGGTTACTGAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_144987.1-194s1c1
Sequence:CCGGAGAGATGAATGTGTGCGACAACTCGAGTTGTCGCACACATTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_144987.1-458s1c1
Sequence:CCGGCGAGAGAGGAACCATCGGTGTCTCGAGACACCGATGGTTCCTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_144987.1-230s1c1
Sequence:CCGGCGTGGGCAACGTCTATGTCAACTCGAGTTGACATAGACGTTGCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144987.2-579s21c1
Sequence:CCGGTGGCAGGACCTCTCCTCAAAGCTCGAGCTTTGAGGAGAGGTCCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144987.2-458s21c1
Sequence:CCGGAGGTTCCATACTGGCCACCATCTCGAGATGGTGGCCAGTATGGAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144987.2-267s21c1
Sequence:CCGGTATGTCAAGTTCCGGAGGGAGCTCGAGCTCCCTCCGGAACTTGACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144987.2-79s21c1
Sequence:CCGGAGAAGGACAAGGTTAACTGCTCTCGAGAGCAGTTAACCTTGTCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144987
VALIDATED
U2AF1L4 MISSION shRNA Lentiviral Transduction Particles
U2 small nuclear RNA auxiliary factor 1-like 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_144987.1-125s1c1
Sequence:CCGGGCTTCACAACAAGCCGACATTCTCGAGAATGTCGGCTTGTTGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_144987.1-287s1c1
Sequence:CCGGTGAACTCAGTAACCGCTGGTTCTCGAGAACCAGCGGTTACTGAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_144987.1-194s1c1
Sequence:CCGGAGAGATGAATGTGTGCGACAACTCGAGTTGTCGCACACATTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_144987.1-458s1c1
Sequence:CCGGCGAGAGAGGAACCATCGGTGTCTCGAGACACCGATGGTTCCTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_144987.1-230s1c1
Sequence:CCGGCGTGGGCAACGTCTATGTCAACTCGAGTTGACATAGACGTTGCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144987.2-579s21c1
Sequence:CCGGTGGCAGGACCTCTCCTCAAAGCTCGAGCTTTGAGGAGAGGTCCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144987.2-458s21c1
Sequence:CCGGAGGTTCCATACTGGCCACCATCTCGAGATGGTGGCCAGTATGGAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144987.2-267s21c1
Sequence:CCGGTATGTCAAGTTCCGGAGGGAGCTCGAGCTCCCTCCGGAACTTGACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144987.2-79s21c1
Sequence:CCGGAGAAGGACAAGGTTAACTGCTCTCGAGAGCAGTTAACCTTGTCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks