EMAIL THIS PAGE TO A FRIEND

U2AF2

U2 small nuclear RNA auxiliary factor 2

Synonyms: U2AF65
UniProtKB ID: P26368, Q96HC5
Gene ID:
Human(11338) Summary: U2 auxiliary factor (U2AF), comprised of a large and a small subunit, is a non-snRNP protein required for the binding of U2 snRNP to the pre-mRNA branch site. This gene encodes the U2AF large subunit which contains a sequence-specific RNA-binding region with 3 RNA recognition motifs and an Arg/Ser-rich domain necessary for splicing. The large subunit binds to the polypyrimidine tract of introns early during spliceosome assembly. Multiple transcript variants have been detected for this gene, but the full-length natures of only two have been determined to date. [provided by RefSeq, Jul 2008]
Mouse(22185) U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 2
Rat(308335) U2 small nuclear RNA auxiliary factor 2
Horse(100050729) U2 small nuclear RNA auxiliary factor 2
dog(100687048) U2 small nuclear RNA auxiliary factor 2
domestic cat(101082705) U2 small nuclear RNA auxiliary factor 2
cow(507895) U2 small nuclear RNA auxiliary factor 2
sheep(101117445) U2 small nuclear RNA auxiliary factor 2
naked mole-rat(101725252) U2 small nuclear RNA auxiliary factor 2
domestic guinea pig(100733836) U2 small nuclear RNA auxiliary factor 2
140 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV40284 Anti-U2AF2 antibody produced in rabbit IgG fraction of antiserum mouse, rat, canine, zebrafish, human, guinea pig, horse, bovine
western blot pricing
SAB2701232 Anti-U2AF2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
HPA043562 Anti-U2AF2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA041943 Anti-U2AF2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
U4758 Monoclonal Anti-U2AF65 antibody produced in mouse clone MC3, purified from hybridoma cell culture rat, human, mouse, Xenopus
electron microscopy, ELISA, immunocytochemistry, immunohistochemistry, immunoprecipitation, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007279 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007279 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007279 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133671 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133671 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133671 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012478 Rosetta Predictions human pricing
NM_007279 Rosetta Predictions human pricing
XM_001059746 Rosetta Predictions rat pricing
XM_001059801 Rosetta Predictions rat pricing
XM_001059867 Rosetta Predictions rat pricing
XM_001060001 Rosetta Predictions rat pricing
XM_001060064 Rosetta Predictions rat pricing
XM_001060115 Rosetta Predictions rat pricing
XM_001077658 Rosetta Predictions rat pricing
NM_133671 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012478 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089990 predicted 1107
2 SASI_Hs02_00306155 predicted 1683
3 SASI_Hs01_00089991 predicted 1239
4 SASI_Hs01_00089992 predicted 1503
5 SASI_Hs01_00089993 predicted 1384
6 SASI_Hs01_00089994 predicted 1847
7 SASI_Hs02_00306156 predicted 1609
8 SASI_Hs01_00089995 predicted 1234
9 SASI_Hs01_00089996 predicted 1368
10 SASI_Hs01_00089997 predicted 1254
11 SASI_Hs01_00089998 predicted 1686
12 SASI_Hs01_00089999 predicted 1681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007279 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056725 predicted 1098
2 SASI_Hs02_00343335 predicted 1685
3 SASI_Hs01_00056726 predicted 1242
4 SASI_Hs01_00056727 predicted 1494
5 SASI_Hs01_00056728 predicted 1376
6 SASI_Hs01_00056729 predicted 1850
7 SASI_Hs02_00343336 predicted 1609
8 SASI_Hs01_00056730 predicted 1233
9 SASI_Hs01_00056731 predicted 1366
10 SASI_Hs01_00056732 predicted 1256
11 SASI_Hs01_00056733 predicted 1683
12 SASI_Hs01_00056734 predicted 1680
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059746 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294200 predicted 839
2 SASI_Rn02_00294201 predicted 809
3 SASI_Rn02_00294202 predicted 500
4 SASI_Rn02_00294203 predicted 194
5 SASI_Rn02_00294204 predicted 1201
6 SASI_Rn02_00294205 predicted 855
7 SASI_Rn02_00294206 predicted 895
8 SASI_Rn02_00294207 predicted 746
9 SASI_Rn02_00294208 predicted 264
10 SASI_Rn02_00294209 predicted 1241
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059801 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294389 predicted 810
2 SASI_Rn02_00294390 predicted 778
3 SASI_Rn02_00294391 predicted 497
4 SASI_Rn02_00294392 predicted 195
5 SASI_Rn02_00294393 predicted 1177
6 SASI_Rn02_00294394 predicted 814
7 SASI_Rn02_00294395 predicted 865
8 SASI_Rn02_00294396 predicted 847
9 SASI_Rn02_00294397 predicted 263
10 SASI_Rn02_00294398 predicted 1218
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059867 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294634 predicted 659
2 SASI_Rn02_00294635 predicted 417
3 SASI_Rn02_00294636 predicted 623
4 SASI_Rn02_00294637 predicted 689
5 SASI_Rn02_00294638 predicted 844
6 SASI_Rn02_00294639 predicted 405
7 SASI_Rn02_00294640 predicted 1027
8 SASI_Rn02_00294641 predicted 882
9 SASI_Rn02_00294642 predicted 758
10 SASI_Rn02_00294643 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060001 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295062 predicted 1466
2 SASI_Rn02_00295063 predicted 1430
3 SASI_Rn02_00295064 predicted 1502
4 SASI_Rn02_00295065 predicted 1646
5 SASI_Rn02_00295066 predicted 1833
6 SASI_Rn02_00295067 predicted 1693
7 SASI_Rn02_00295068 predicted 1565
8 SASI_Rn02_00295069 predicted 1466
9 SASI_Rn02_00295070 predicted 1512
10 SASI_Rn02_00295071 predicted 1505
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060064 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295232 predicted 762
2 SASI_Rn02_00295233 predicted 724
3 SASI_Rn02_00295234 predicted 448
4 SASI_Rn02_00295235 predicted 1128
5 SASI_Rn02_00295236 predicted 766
6 SASI_Rn02_00295237 predicted 813
7 SASI_Rn02_00295238 predicted 797
8 SASI_Rn02_00295239 predicted 212
9 SASI_Rn02_00295240 predicted 1167
10 SASI_Rn02_00295241 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060115 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295427 predicted 833
2 SASI_Rn02_00295428 predicted 795
3 SASI_Rn02_00295429 predicted 525
4 SASI_Rn02_00295430 predicted 226
5 SASI_Rn02_00295431 predicted 1202
6 SASI_Rn02_00295432 predicted 844
7 SASI_Rn02_00295433 predicted 881
8 SASI_Rn02_00295434 predicted 874
9 SASI_Rn02_00295435 predicted 284
10 SASI_Rn02_00295436 predicted 1242
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077658 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00357949 predicted 80
2 SASI_Rn02_00357950 predicted 107
3 SASI_Rn02_00357951 predicted 79
4 SASI_Rn02_00357952 predicted 64
5 SASI_Rn02_00357953 predicted 14
6 SASI_Rn02_00357954 predicted 58
7 SASI_Rn02_00357955 predicted 80
8 SASI_Rn02_00357956 predicted 75
9 SASI_Rn02_00357957 predicted 18
10 SASI_Rn02_00357958 predicted 53
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133671 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338612 predicted 587
2 SASI_Mm01_00024654 predicted 950
3 SASI_Mm01_00024652 predicted 861
4 SASI_Mm02_00338613 predicted 287
5 SASI_Mm02_00338614 predicted 736
6 SASI_Mm02_00338615 predicted 550
7 SASI_Mm01_00024661 predicted 1379
8 SASI_Mm02_00338616 predicted 904
9 SASI_Mm02_00338617 predicted 957
10 SASI_Mm02_00338618 predicted 1207
11 SASI_Mm01_00024653 predicted 1439
12 SASI_Mm01_00024655 predicted 1064
13 SASI_Mm01_00024656 predicted 1599
14 SASI_Mm01_00024657 predicted 1408
15 SASI_Mm01_00024658 predicted 1181
16 SASI_Mm01_00024659 predicted 1673
17 SASI_Mm01_00024660 predicted 1285
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007279
VALIDATED
U2AF2 MISSION shRNA Bacterial Glycerol Stock
U2 small nuclear RNA auxiliary factor 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007279.2-1611s21c1
Sequence:CCGGGTGTTGGCTGTGCAGATTAACCTCGAGGTTAATCTGCACAGCCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007279.2-2228s21c1
Sequence:CCGGCGACGAGGAGTATGAGGAGATCTCGAGATCTCCTCATACTCCTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007279.2-1307s21c1
Sequence:CCGGGAAGAAGAAGGTCCGTAAATACTCGAGTATTTACGGACCTTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007279.2-2847s21c1
Sequence:CCGGGGTAGGAACATAGCGTGTTTACTCGAGTAAACACGCTATGTTCCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007279.2-1245s21c1
Sequence:CCGGCCTTTGACCAGAGGCGCTAAACTCGAGTTTAGCGCCTCTGGTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007279.x-1545s1c1
Sequence:CCGGGAAGACGATGGGCAGAGGAGTCTCGAGACTCCTCTGCCCATCGTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007279.x-289s1c1
Sequence:CCGGGAAGAAGAAGAAGGTCCGTAACTCGAGTTACGGACCTTCTTCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007279.x-1213s1c1
Sequence:CCGGCGACGAGGAGTATGAGGAGATCTCGAGATCTCCTCATACTCCTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007279.x-946s1c1
Sequence:CCGGCGCCTTCTGTGAGTACGTGGACTCGAGTCCACGTACTCACAGAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007279.x-606s1c1
Sequence:CCGGTGCAGATTAACCAGGACAAGACTCGAGTCTTGTCCTGGTTAATCTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007279
VALIDATED
U2AF2 MISSION shRNA shRNA Plasmid DNA
U2 small nuclear RNA auxiliary factor 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007279.2-1611s21c1
Sequence:CCGGGTGTTGGCTGTGCAGATTAACCTCGAGGTTAATCTGCACAGCCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007279.2-2228s21c1
Sequence:CCGGCGACGAGGAGTATGAGGAGATCTCGAGATCTCCTCATACTCCTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007279.2-1307s21c1
Sequence:CCGGGAAGAAGAAGGTCCGTAAATACTCGAGTATTTACGGACCTTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007279.2-2847s21c1
Sequence:CCGGGGTAGGAACATAGCGTGTTTACTCGAGTAAACACGCTATGTTCCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007279.2-1245s21c1
Sequence:CCGGCCTTTGACCAGAGGCGCTAAACTCGAGTTTAGCGCCTCTGGTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007279.x-1545s1c1
Sequence:CCGGGAAGACGATGGGCAGAGGAGTCTCGAGACTCCTCTGCCCATCGTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007279.x-289s1c1
Sequence:CCGGGAAGAAGAAGAAGGTCCGTAACTCGAGTTACGGACCTTCTTCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007279.x-1213s1c1
Sequence:CCGGCGACGAGGAGTATGAGGAGATCTCGAGATCTCCTCATACTCCTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007279.x-946s1c1
Sequence:CCGGCGCCTTCTGTGAGTACGTGGACTCGAGTCCACGTACTCACAGAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007279.x-606s1c1
Sequence:CCGGTGCAGATTAACCAGGACAAGACTCGAGTCTTGTCCTGGTTAATCTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007279
VALIDATED
U2AF2 MISSION shRNA Lentiviral Transduction Particles
U2 small nuclear RNA auxiliary factor 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007279.2-1611s21c1
Sequence:CCGGGTGTTGGCTGTGCAGATTAACCTCGAGGTTAATCTGCACAGCCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007279.2-2228s21c1
Sequence:CCGGCGACGAGGAGTATGAGGAGATCTCGAGATCTCCTCATACTCCTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007279.2-1307s21c1
Sequence:CCGGGAAGAAGAAGGTCCGTAAATACTCGAGTATTTACGGACCTTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007279.2-2847s21c1
Sequence:CCGGGGTAGGAACATAGCGTGTTTACTCGAGTAAACACGCTATGTTCCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007279.2-1245s21c1
Sequence:CCGGCCTTTGACCAGAGGCGCTAAACTCGAGTTTAGCGCCTCTGGTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007279.x-1545s1c1
Sequence:CCGGGAAGACGATGGGCAGAGGAGTCTCGAGACTCCTCTGCCCATCGTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007279.x-289s1c1
Sequence:CCGGGAAGAAGAAGAAGGTCCGTAACTCGAGTTACGGACCTTCTTCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007279.x-1213s1c1
Sequence:CCGGCGACGAGGAGTATGAGGAGATCTCGAGATCTCCTCATACTCCTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007279.x-946s1c1
Sequence:CCGGCGCCTTCTGTGAGTACGTGGACTCGAGTCCACGTACTCACAGAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007279.x-606s1c1
Sequence:CCGGTGCAGATTAACCAGGACAAGACTCGAGTCTTGTCCTGGTTAATCTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133671
VALIDATED
U2AF2 MISSION shRNA Bacterial Glycerol Stock
U2 small nuclear RNA auxiliary factor 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133671.2-1869s21c1
Sequence:CCGGGGTAGGAACATAGCGTGTTTACTCGAGTAAACACGCTATGTTCCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133671.2-790s21c1
Sequence:CCGGGCCTCATGACTATCAGCCATTCTCGAGAATGGCTGATAGTCATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133671.2-670s21c1
Sequence:CCGGTGTGCAGATAAATCAAGACAACTCGAGTTGTCTTGATTTATCTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133671.2-1394s21c1
Sequence:CCGGGTGGAGTTCACCTCTGTGTTTCTCGAGAAACACAGAGGTGAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133671.2-358s21c1
Sequence:CCGGGAAGAAGAAGGTGCGTAAATACTCGAGTATTTACGCACCTTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109095    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133671.1-1917s1c1
Sequence:CCGGGCAACTGGAATGGCAGCAATTCTCGAGAATTGCTGCCATTCCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133671.1-1063s1c1
Sequence:CCGGGCCTCATGACTATCAGCCATTCTCGAGAATGGCTGATAGTCATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133671.1-1667s1c1
Sequence:CCGGGTGGAGTTCACCTCTGTGTTTCTCGAGAAACACAGAGGTGAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133671.1-943s1c1
Sequence:CCGGTGTGCAGATAAATCAAGACAACTCGAGTTGTCTTGATTTATCTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133671.1-1186s1c1
Sequence:CCGGCCTAAATGATGACCAGGTAAACTCGAGTTTACCTGGTCATCATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133671
VALIDATED
U2AF2 MISSION shRNA shRNA Plasmid DNA
U2 small nuclear RNA auxiliary factor 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133671.2-1869s21c1
Sequence:CCGGGGTAGGAACATAGCGTGTTTACTCGAGTAAACACGCTATGTTCCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133671.2-790s21c1
Sequence:CCGGGCCTCATGACTATCAGCCATTCTCGAGAATGGCTGATAGTCATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133671.2-670s21c1
Sequence:CCGGTGTGCAGATAAATCAAGACAACTCGAGTTGTCTTGATTTATCTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133671.2-1394s21c1
Sequence:CCGGGTGGAGTTCACCTCTGTGTTTCTCGAGAAACACAGAGGTGAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133671.2-358s21c1
Sequence:CCGGGAAGAAGAAGGTGCGTAAATACTCGAGTATTTACGCACCTTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109095    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133671.1-1917s1c1
Sequence:CCGGGCAACTGGAATGGCAGCAATTCTCGAGAATTGCTGCCATTCCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133671.1-1063s1c1
Sequence:CCGGGCCTCATGACTATCAGCCATTCTCGAGAATGGCTGATAGTCATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133671.1-1667s1c1
Sequence:CCGGGTGGAGTTCACCTCTGTGTTTCTCGAGAAACACAGAGGTGAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133671.1-943s1c1
Sequence:CCGGTGTGCAGATAAATCAAGACAACTCGAGTTGTCTTGATTTATCTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133671.1-1186s1c1
Sequence:CCGGCCTAAATGATGACCAGGTAAACTCGAGTTTACCTGGTCATCATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133671
VALIDATED
U2AF2 MISSION shRNA Lentiviral Transduction Particles
U2 small nuclear RNA auxiliary factor 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133671.2-1869s21c1
Sequence:CCGGGGTAGGAACATAGCGTGTTTACTCGAGTAAACACGCTATGTTCCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133671.2-790s21c1
Sequence:CCGGGCCTCATGACTATCAGCCATTCTCGAGAATGGCTGATAGTCATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133671.2-670s21c1
Sequence:CCGGTGTGCAGATAAATCAAGACAACTCGAGTTGTCTTGATTTATCTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133671.2-1394s21c1
Sequence:CCGGGTGGAGTTCACCTCTGTGTTTCTCGAGAAACACAGAGGTGAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133671.2-358s21c1
Sequence:CCGGGAAGAAGAAGGTGCGTAAATACTCGAGTATTTACGCACCTTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109095    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133671.1-1917s1c1
Sequence:CCGGGCAACTGGAATGGCAGCAATTCTCGAGAATTGCTGCCATTCCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133671.1-1063s1c1
Sequence:CCGGGCCTCATGACTATCAGCCATTCTCGAGAATGGCTGATAGTCATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133671.1-1667s1c1
Sequence:CCGGGTGGAGTTCACCTCTGTGTTTCTCGAGAAACACAGAGGTGAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133671.1-943s1c1
Sequence:CCGGTGTGCAGATAAATCAAGACAACTCGAGTTGTCTTGATTTATCTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133671.1-1186s1c1
Sequence:CCGGCCTAAATGATGACCAGGTAAACTCGAGTTTACCTGGTCATCATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks