EMAIL THIS PAGE TO A FRIEND

U2SURP

U2 snRNP-associated SURP domain containing

Synonyms: SR140 fSAPa
UniProtKB ID: O15042, A0PJ60, Q0D2M1, Q2NKQ7, Q9BR70
Gene ID:
Mouse(67958) U2 snRNP-associated SURP domain containing
Rat(315903) U2 snRNP-associated SURP domain containing
Zebrafish(567461) U2 snRNP-associated SURP domain containing
chicken(424773) U2 snRNP-associated SURP domain containing
dog(477103) U2 snRNP-associated SURP domain containing
Horse(100051188) U2 snRNP-associated SURP domain containing
domestic cat(101087262) U2 snRNP-associated SURP domain containing
domestic guinea pig(100733540) U2 snRNP-associated SURP domain containing
naked mole-rat(101705423) U2 snRNP-associated SURP domain containing
cow(505019) U2 snRNP-associated SURP domain containing
sheep(101104449) U2 snRNP-associated SURP domain containing
323 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_031553 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_031553 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_031553 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_135073 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_135073 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_135073 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080415 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080415 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080415 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080415 Rosetta Predictions human pricing
XM_031553 Rosetta Predictions human pricing
XM_001064961 Rosetta Predictions rat pricing
XM_001065014 Rosetta Predictions rat pricing
XM_236501 Rosetta Predictions rat pricing
NM_001114977 Rosetta Predictions mouse pricing
NM_026476 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314626 predicted 1465
2 SASI_Hs02_00314627 predicted 1805
3 SASI_Hs02_00314628 predicted 258
4 SASI_Hs02_00314629 predicted 897
5 SASI_Hs02_00314630 predicted 1998
6 SASI_Hs02_00314631 predicted 1271
7 SASI_Hs02_00314632 predicted 1620
8 SASI_Hs02_00314633 predicted 279
9 SASI_Hs02_00314634 predicted 1546
10 SASI_Hs02_00314635 predicted 1897
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_031553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00250572 predicted 303
2 SASI_Hs01_00250573 predicted 1884
3 SASI_Hs01_00250574 predicted 341
4 SASI_Hs01_00250575 predicted 2078
5 SASI_Hs01_00250576 predicted 1696
6 SASI_Hs01_00250577 predicted 3082
7 SASI_Hs01_00250578 predicted 2144
8 SASI_Hs01_00250579 predicted 362
9 SASI_Hs01_00250580 predicted 1971
10 SASI_Hs01_00250581 predicted 2120
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064961 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312365 predicted 1441
2 SASI_Rn02_00312366 predicted 1954
3 SASI_Rn02_00312367 predicted 1360
4 SASI_Rn02_00312368 predicted 1971
5 SASI_Rn02_00312369 predicted 1927
6 SASI_Rn02_00312370 predicted 2069
7 SASI_Rn02_00312371 predicted 1258
8 SASI_Rn02_00312372 predicted 1677
9 SASI_Rn02_00312373 predicted 289
10 SASI_Rn02_00312374 predicted 2209
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065014 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312550 predicted 1388
2 SASI_Rn02_00312551 predicted 1904
3 SASI_Rn02_00312552 predicted 1307
4 SASI_Rn02_00312553 predicted 1921
5 SASI_Rn02_00312554 predicted 1877
6 SASI_Rn02_00312555 predicted 2021
7 SASI_Rn02_00312556 predicted 1588
8 SASI_Rn02_00312557 predicted 1204
9 SASI_Rn02_00312558 predicted 1623
10 SASI_Rn02_00312559 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236501 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390089 predicted 1389
2 SASI_Rn02_00390090 predicted 1909
3 SASI_Rn02_00390091 predicted 1304
4 SASI_Rn02_00390092 predicted 1924
5 SASI_Rn02_00390093 predicted 1880
6 SASI_Rn02_00390094 predicted 2025
7 SASI_Rn02_00390095 predicted 1590
8 SASI_Rn02_00390096 predicted 1209
9 SASI_Rn02_00390097 predicted 1622
10 SASI_Rn02_00390098 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114977 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308847 predicted 1497
2 SASI_Mm02_00308848 predicted 2016
3 SASI_Mm02_00308849 predicted 1232
4 SASI_Mm02_00308850 predicted 1415
5 SASI_Mm02_00308851 predicted 2467
6 SASI_Mm02_00308852 predicted 1896
7 SASI_Mm02_00308853 predicted 2036
8 SASI_Mm02_00308854 predicted 2459
9 SASI_Mm02_00308855 predicted 2135
10 SASI_Mm02_00308856 predicted 2369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026476 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182640 predicted 1369
2 SASI_Mm01_00182641 predicted 1882
3 SASI_Mm01_00182643 predicted 1094
4 SASI_Mm01_00182644 predicted 1282
5 SASI_Mm02_00330342 predicted 2335
6 SASI_Mm01_00182645 predicted 1763
7 SASI_Mm01_00182647 predicted 1908
8 SASI_Mm01_00182648 predicted 2324
9 SASI_Mm01_00182649 predicted 1998
10 SASI_Mm02_00330343 predicted 2238
11 SASI_Mm01_00182642 predicted 211
12 SASI_Mm01_00182646 predicted 1803
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_031553
VALIDATED
U2SURP MISSION shRNA Bacterial Glycerol Stock
U2 snRNP-associated SURP domain containing
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031553.8-1480s1c1
Sequence:CCGGGCCCTGATACATCGAATGATACTCGAGTATCATTCGATGTATCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:XM_031553.8-535s1c1
Sequence:CCGGGCTGAGATTTATGAGGAGTTTCTCGAGAAACTCCTCATAAATCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031553.8-3011s1c1
Sequence:CCGGGCAGTGGTAGACGAGTGAAATCTCGAGATTTCACTCGTCTACCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:XM_031553.8-2098s1c1
Sequence:CCGGCGTACAATTCAAGGCCATTTACTCGAGTAAATGGCCTTGAATTGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031553.8-1638s1c1
Sequence:CCGGGCAGGGAGATTCTCCAACTAACTCGAGTTAGTTGGAGAATCTCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_031553
VALIDATED
U2SURP MISSION shRNA shRNA Plasmid DNA
U2 snRNP-associated SURP domain containing
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031553.8-1480s1c1
Sequence:CCGGGCCCTGATACATCGAATGATACTCGAGTATCATTCGATGTATCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:XM_031553.8-535s1c1
Sequence:CCGGGCTGAGATTTATGAGGAGTTTCTCGAGAAACTCCTCATAAATCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031553.8-3011s1c1
Sequence:CCGGGCAGTGGTAGACGAGTGAAATCTCGAGATTTCACTCGTCTACCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:XM_031553.8-2098s1c1
Sequence:CCGGCGTACAATTCAAGGCCATTTACTCGAGTAAATGGCCTTGAATTGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031553.8-1638s1c1
Sequence:CCGGGCAGGGAGATTCTCCAACTAACTCGAGTTAGTTGGAGAATCTCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_031553
VALIDATED
U2SURP MISSION shRNA Lentiviral Transduction Particles
U2 snRNP-associated SURP domain containing
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031553.8-1480s1c1
Sequence:CCGGGCCCTGATACATCGAATGATACTCGAGTATCATTCGATGTATCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:XM_031553.8-535s1c1
Sequence:CCGGGCTGAGATTTATGAGGAGTTTCTCGAGAAACTCCTCATAAATCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031553.8-3011s1c1
Sequence:CCGGGCAGTGGTAGACGAGTGAAATCTCGAGATTTCACTCGTCTACCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:XM_031553.8-2098s1c1
Sequence:CCGGCGTACAATTCAAGGCCATTTACTCGAGTAAATGGCCTTGAATTGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031553.8-1638s1c1
Sequence:CCGGGCAGGGAGATTCTCCAACTAACTCGAGTTAGTTGGAGAATCTCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_135073
U2SURP MISSION shRNA Bacterial Glycerol Stock
U2 snRNP-associated SURP domain containing
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_135073.4-3971s1c1
Sequence:CCGGGCCCATCTTCTGAGCAATTAACTCGAGTTAATTGCTCAGAAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135073.4-2606s1c1
Sequence:CCGGCGACTGAGTCTAAGTTCTCTACTCGAGTAGAGAACTTAGACTCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135073.4-1648s1c1
Sequence:CCGGCCACCTTTAAATCCATACCTTCTCGAGAAGGTATGGATTTAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135073.4-1746s1c1
Sequence:CCGGGCGGGATAAGTTAGAAGAAATCTCGAGATTTCTTCTAACTTATCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135073.4-2113s1c1
Sequence:CCGGGCAATTTATCCAGAACCATTTCTCGAGAAATGGTTCTGGATAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_135073
U2SURP MISSION shRNA shRNA Plasmid DNA
U2 snRNP-associated SURP domain containing
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_135073.4-3971s1c1
Sequence:CCGGGCCCATCTTCTGAGCAATTAACTCGAGTTAATTGCTCAGAAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135073.4-2606s1c1
Sequence:CCGGCGACTGAGTCTAAGTTCTCTACTCGAGTAGAGAACTTAGACTCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135073.4-1648s1c1
Sequence:CCGGCCACCTTTAAATCCATACCTTCTCGAGAAGGTATGGATTTAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135073.4-1746s1c1
Sequence:CCGGGCGGGATAAGTTAGAAGAAATCTCGAGATTTCTTCTAACTTATCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135073.4-2113s1c1
Sequence:CCGGGCAATTTATCCAGAACCATTTCTCGAGAAATGGTTCTGGATAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_135073
U2SURP MISSION shRNA Lentiviral Transduction Particles
U2 snRNP-associated SURP domain containing
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_135073.4-3971s1c1
Sequence:CCGGGCCCATCTTCTGAGCAATTAACTCGAGTTAATTGCTCAGAAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135073.4-2606s1c1
Sequence:CCGGCGACTGAGTCTAAGTTCTCTACTCGAGTAGAGAACTTAGACTCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135073.4-1648s1c1
Sequence:CCGGCCACCTTTAAATCCATACCTTCTCGAGAAGGTATGGATTTAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135073.4-1746s1c1
Sequence:CCGGGCGGGATAAGTTAGAAGAAATCTCGAGATTTCTTCTAACTTATCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135073.4-2113s1c1
Sequence:CCGGGCAATTTATCCAGAACCATTTCTCGAGAAATGGTTCTGGATAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080415
U2SURP MISSION shRNA Bacterial Glycerol Stock
U2 snRNP-associated SURP domain containing
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080415.1-2002s21c1
Sequence:CCGGCGTACAATTCAAGGCCATTTACTCGAGTAAATGGCCTTGAATTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080415.1-2619s21c1
Sequence:CCGGACGAGCCAAACTTCGTGAAATCTCGAGATTTCACGAAGTTTGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080415.1-906s21c1
Sequence:CCGGAGATCCAAGCACTACTAATTTCTCGAGAAATTAGTAGTGCTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080415.1-2268s21c1
Sequence:CCGGTCTTGATGGAGTCCCTATAAACTCGAGTTTATAGGGACTCCATCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080415.1-3379s21c1
Sequence:CCGGTACTTTCATTGTGGCTATTTCCTCGAGGAAATAGCCACAATGAAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080415
U2SURP MISSION shRNA shRNA Plasmid DNA
U2 snRNP-associated SURP domain containing
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080415.1-2002s21c1
Sequence:CCGGCGTACAATTCAAGGCCATTTACTCGAGTAAATGGCCTTGAATTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080415.1-2619s21c1
Sequence:CCGGACGAGCCAAACTTCGTGAAATCTCGAGATTTCACGAAGTTTGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080415.1-906s21c1
Sequence:CCGGAGATCCAAGCACTACTAATTTCTCGAGAAATTAGTAGTGCTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080415.1-2268s21c1
Sequence:CCGGTCTTGATGGAGTCCCTATAAACTCGAGTTTATAGGGACTCCATCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080415.1-3379s21c1
Sequence:CCGGTACTTTCATTGTGGCTATTTCCTCGAGGAAATAGCCACAATGAAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080415
U2SURP MISSION shRNA Lentiviral Transduction Particles
U2 snRNP-associated SURP domain containing
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080415.1-2002s21c1
Sequence:CCGGCGTACAATTCAAGGCCATTTACTCGAGTAAATGGCCTTGAATTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080415.1-2619s21c1
Sequence:CCGGACGAGCCAAACTTCGTGAAATCTCGAGATTTCACGAAGTTTGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080415.1-906s21c1
Sequence:CCGGAGATCCAAGCACTACTAATTTCTCGAGAAATTAGTAGTGCTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080415.1-2268s21c1
Sequence:CCGGTCTTGATGGAGTCCCTATAAACTCGAGTTTATAGGGACTCCATCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080415.1-3379s21c1
Sequence:CCGGTACTTTCATTGTGGCTATTTCCTCGAGGAAATAGCCACAATGAAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks