EMAIL THIS PAGE TO A FRIEND

UACA

uveal autoantigen with coiled-coil domains and ankyrin repeats

Synonyms: NUCLING
Gene ID:
Mouse(72565) uveal autoantigen with coiled-coil domains and ankyrin repeats
Rat(315732) uveal autoantigen with coiled-coil domains and ankyrin repeats
cow(281559) uveal autoantigen with coiled-coil domains and ankyrin repeats
domestic guinea pig(100733830) uveal autoantigen with coiled-coil domains and ankyrin repeats
naked mole-rat(101697156) uveal autoantigen with coiled-coil domains and ankyrin repeats
Domestic Rabbit(100340617) uveal autoantigen with coiled-coil domains and ankyrin repeats
chicken(415569) uveal autoantigen with coiled-coil domains and ankyrin repeats
dog(403704) uveal autoantigen with coiled-coil domains and ankyrin repeats
domestic cat(101094931) uveal autoantigen with coiled-coil domains and ankyrin repeats
125 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018003 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018003 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018003 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028283 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028283 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028283 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008224 Rosetta Predictions human pricing
NM_018003 Rosetta Predictions human pricing
XM_001073577 Rosetta Predictions rat pricing
XM_236339 Rosetta Predictions rat pricing
NM_028283 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008224 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066767 predicted 1653
2 SASI_Hs02_00305383 predicted 2795
3 SASI_Hs01_00066770 predicted 754
4 SASI_Hs02_00305384 predicted 1392
5 SASI_Hs01_00066771 predicted 3230
6 SASI_Hs01_00066772 predicted 1045
7 SASI_Hs01_00066773 predicted 1805
8 SASI_Hs01_00066774 predicted 881
9 SASI_Hs02_00305385 predicted 2691
10 SASI_Hs01_00066776 predicted 3249
11 SASI_Hs01_00066768 predicted 1843
12 SASI_Hs01_00066769 predicted 1029
13 SASI_Hs01_00066775 predicted 3981
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018003 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062339 predicted 1433
2 SASI_Hs02_00351074 predicted 2566
3 SASI_Hs01_00062342 predicted 532
4 SASI_Hs02_00351075 predicted 1176
5 SASI_Hs01_00062343 predicted 3010
6 SASI_Hs01_00062344 predicted 824
7 SASI_Hs01_00062345 predicted 1577
8 SASI_Hs01_00062346 predicted 661
9 SASI_Hs02_00351076 predicted 2472
10 SASI_Hs01_00062348 predicted 3026
11 SASI_Hs01_00062340 predicted 1621
12 SASI_Hs01_00062341 predicted 800
13 SASI_Hs01_00062347 predicted 3762
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073577 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343233 predicted 310
2 SASI_Rn02_00343234 predicted 2602
3 SASI_Rn02_00343235 predicted 1325
4 SASI_Rn02_00343236 predicted 3909
5 SASI_Rn02_00343237 predicted 3529
6 SASI_Rn02_00343238 predicted 1024
7 SASI_Rn02_00343239 predicted 694
8 SASI_Rn02_00343240 predicted 1142
9 SASI_Rn02_00343241 predicted 2441
10 SASI_Rn02_00343242 predicted 1826
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236339 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00126696 predicted 2928
2 SASI_Rn01_00126697 predicted 1587
3 SASI_Rn01_00126698 predicted 5593
4 SASI_Rn01_00126699 predicted 6274
5 SASI_Rn01_00126700 predicted 1012
6 SASI_Rn01_00126701 predicted 4227
7 SASI_Rn01_00126702 predicted 3842
8 SASI_Rn01_00126703 predicted 1054
9 SASI_Rn01_00126704 predicted 2751
10 SASI_Rn01_00126705 predicted 6286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028283 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073076 predicted 1038
2 SASI_Mm01_00073077 predicted 2344
3 SASI_Mm01_00073078 predicted 922
4 SASI_Mm01_00073079 predicted 768
5 SASI_Mm01_00073080 predicted 2307
6 SASI_Mm01_00073081 predicted 1027
7 SASI_Mm01_00073082 predicted 673
8 SASI_Mm01_00073083 predicted 3435
9 SASI_Mm01_00073084 predicted 3446
10 SASI_Mm01_00073085 predicted 2432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018003
VALIDATED
UACA MISSION shRNA Bacterial Glycerol Stock
uveal autoantigen with coiled-coil domains and ankyrin repeats
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018003.2-4665s21c1
Sequence:CCGGAGCGAGGTTAGGCTGAAATAACTCGAGTTATTTCAGCCTAACCTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018003.1-310s1c1
Sequence:CCGGCCTTATACATGGAGTTGATATCTCGAGATATCAACTCCATGTATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018003.1-131s1c1
Sequence:CCGGGCAGCAGATTGGAATAAATATCTCGAGATATTTATTCCAATCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018003.1-1614s1c1
Sequence:CCGGCCCTTAAAGAACACTTAACAACTCGAGTTGTTAAGTGTTCTTTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018003.1-3130s1c1
Sequence:CCGGGCAAGAGAATGACAAGTTAAACTCGAGTTTAACTTGTCATTCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018003.1-2111s1c1
Sequence:CCGGGAACAGGTTAAGAGCAGATTACTCGAGTAATCTGCTCTTAACCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018003.1-896s1c1
Sequence:CCGGGAAGTAAATGTGAAGTCACATCTCGAGATGTGACTTCACATTTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018003.1-3898s1c1
Sequence:CCGGGCAAGAAATTAAGGATCAGAACTCGAGTTCTGATCCTTAATTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018003.1-3247s1c1
Sequence:CCGGCGAGCTAAACAAACAGTTAAACTCGAGTTTAACTGTTTGTTTAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018003.1-3791s1c1
Sequence:CCGGGCCAATCTGAATAGAAAGTATCTCGAGATACTTTCTATTCAGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018003.1-1772s1c1
Sequence:CCGGGAAGAGTTTAAGAGGGATGAACTCGAGTTCATCCCTCTTAAACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018003.1-2875s1c1
Sequence:CCGGGCAGGATAGTAATGCTGAAATCTCGAGATTTCAGCATTACTATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018003.1-3548s1c1
Sequence:CCGGGCAGAGCATTTGCAGATTAAACTCGAGTTTAATCTGCAAATGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018003
VALIDATED
UACA MISSION shRNA shRNA Plasmid DNA
uveal autoantigen with coiled-coil domains and ankyrin repeats
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018003.2-4665s21c1
Sequence:CCGGAGCGAGGTTAGGCTGAAATAACTCGAGTTATTTCAGCCTAACCTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018003.1-310s1c1
Sequence:CCGGCCTTATACATGGAGTTGATATCTCGAGATATCAACTCCATGTATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018003.1-131s1c1
Sequence:CCGGGCAGCAGATTGGAATAAATATCTCGAGATATTTATTCCAATCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018003.1-1614s1c1
Sequence:CCGGCCCTTAAAGAACACTTAACAACTCGAGTTGTTAAGTGTTCTTTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018003.1-3130s1c1
Sequence:CCGGGCAAGAGAATGACAAGTTAAACTCGAGTTTAACTTGTCATTCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018003.1-2111s1c1
Sequence:CCGGGAACAGGTTAAGAGCAGATTACTCGAGTAATCTGCTCTTAACCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018003.1-896s1c1
Sequence:CCGGGAAGTAAATGTGAAGTCACATCTCGAGATGTGACTTCACATTTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018003.1-3898s1c1
Sequence:CCGGGCAAGAAATTAAGGATCAGAACTCGAGTTCTGATCCTTAATTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018003.1-3247s1c1
Sequence:CCGGCGAGCTAAACAAACAGTTAAACTCGAGTTTAACTGTTTGTTTAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018003.1-3791s1c1
Sequence:CCGGGCCAATCTGAATAGAAAGTATCTCGAGATACTTTCTATTCAGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018003.1-1772s1c1
Sequence:CCGGGAAGAGTTTAAGAGGGATGAACTCGAGTTCATCCCTCTTAAACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018003.1-2875s1c1
Sequence:CCGGGCAGGATAGTAATGCTGAAATCTCGAGATTTCAGCATTACTATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018003.1-3548s1c1
Sequence:CCGGGCAGAGCATTTGCAGATTAAACTCGAGTTTAATCTGCAAATGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018003
VALIDATED
UACA MISSION shRNA Lentiviral Transduction Particles
uveal autoantigen with coiled-coil domains and ankyrin repeats
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018003.2-4665s21c1
Sequence:CCGGAGCGAGGTTAGGCTGAAATAACTCGAGTTATTTCAGCCTAACCTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018003.1-310s1c1
Sequence:CCGGCCTTATACATGGAGTTGATATCTCGAGATATCAACTCCATGTATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018003.1-131s1c1
Sequence:CCGGGCAGCAGATTGGAATAAATATCTCGAGATATTTATTCCAATCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018003.1-1614s1c1
Sequence:CCGGCCCTTAAAGAACACTTAACAACTCGAGTTGTTAAGTGTTCTTTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018003.1-3130s1c1
Sequence:CCGGGCAAGAGAATGACAAGTTAAACTCGAGTTTAACTTGTCATTCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018003.1-2111s1c1
Sequence:CCGGGAACAGGTTAAGAGCAGATTACTCGAGTAATCTGCTCTTAACCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018003.1-896s1c1
Sequence:CCGGGAAGTAAATGTGAAGTCACATCTCGAGATGTGACTTCACATTTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018003.1-3898s1c1
Sequence:CCGGGCAAGAAATTAAGGATCAGAACTCGAGTTCTGATCCTTAATTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018003.1-3247s1c1
Sequence:CCGGCGAGCTAAACAAACAGTTAAACTCGAGTTTAACTGTTTGTTTAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018003.1-3791s1c1
Sequence:CCGGGCCAATCTGAATAGAAAGTATCTCGAGATACTTTCTATTCAGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018003.1-1772s1c1
Sequence:CCGGGAAGAGTTTAAGAGGGATGAACTCGAGTTCATCCCTCTTAAACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018003.1-2875s1c1
Sequence:CCGGGCAGGATAGTAATGCTGAAATCTCGAGATTTCAGCATTACTATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018003.1-3548s1c1
Sequence:CCGGGCAGAGCATTTGCAGATTAAACTCGAGTTTAATCTGCAAATGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028283
VALIDATED
UACA MISSION shRNA Bacterial Glycerol Stock
uveal autoantigen with coiled-coil domains and ankyrin repeats
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000120482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028283.1-540s1c1
Sequence:CCGGCCTCCGTGAATGCCAAAGATACTCGAGTATCTTTGGCATTCACGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028283.1-2433s1c1
Sequence:CCGGCGGAGAACGATAAGTTGACTACTCGAGTAGTCAACTTATCGTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028283.1-1264s1c1
Sequence:CCGGGCTGCATAAACAAGGTCAAATCTCGAGATTTGACCTTGTTTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028283.1-4183s1c1
Sequence:CCGGCCAAGAAGTTATCGCTATCTACTCGAGTAGATAGCGATAACTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028283
VALIDATED
UACA MISSION shRNA shRNA Plasmid DNA
uveal autoantigen with coiled-coil domains and ankyrin repeats
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000120482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028283.1-540s1c1
Sequence:CCGGCCTCCGTGAATGCCAAAGATACTCGAGTATCTTTGGCATTCACGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028283.1-2433s1c1
Sequence:CCGGCGGAGAACGATAAGTTGACTACTCGAGTAGTCAACTTATCGTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028283.1-1264s1c1
Sequence:CCGGGCTGCATAAACAAGGTCAAATCTCGAGATTTGACCTTGTTTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028283.1-4183s1c1
Sequence:CCGGCCAAGAAGTTATCGCTATCTACTCGAGTAGATAGCGATAACTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028283
VALIDATED
UACA MISSION shRNA Lentiviral Transduction Particles
uveal autoantigen with coiled-coil domains and ankyrin repeats
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000120482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028283.1-540s1c1
Sequence:CCGGCCTCCGTGAATGCCAAAGATACTCGAGTATCTTTGGCATTCACGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028283.1-2433s1c1
Sequence:CCGGCGGAGAACGATAAGTTGACTACTCGAGTAGTCAACTTATCGTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028283.1-1264s1c1
Sequence:CCGGGCTGCATAAACAAGGTCAAATCTCGAGATTTGACCTTGTTTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028283.1-4183s1c1
Sequence:CCGGCCAAGAAGTTATCGCTATCTACTCGAGTAGATAGCGATAACTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks