EMAIL THIS PAGE TO A FRIEND

UAP1

UDP-N-acteylglucosamine pyrophosphorylase 1

Synonyms: AGX AGX1 AGX2 SPAG2
UniProtKB ID: Q16222, B2R6R8, Q5VTA9, Q5VTB0, Q5VTB1, Q96GM2
Gene ID:
Mouse(107652) UDP-N-acetylglucosamine pyrophosphorylase 1
Rat(498272) UDP-N-acteylglucosamine pyrophosphorylase 1
Zebrafish(322513) UDP-N-acteylglucosamine pyrophosphorylase 1
chicken(424368) UDP-N-acteylglucosamine pyrophosphorylase 1
domestic cat(101083738) UDP-N-acteylglucosamine pyrophosphorylase 1
Horse(100058864) UDP-N-acteylglucosamine pyrophosphorylase 1
dog(488664) UDP-N-acteylglucosamine pyrophosphorylase 1
domestic guinea pig(100729068) UDP-N-acteylglucosamine pyrophosphorylase 1
Domestic Rabbit(100339004) UDP-N-acteylglucosamine pyrophosphorylase 1
naked mole-rat(101710542) UDP-N-acteylglucosamine pyrophosphorylase 1
cow(535325) UDP-N-acteylglucosamine pyrophosphorylase 1
sheep(101109315) UDP-N-acteylglucosamine pyrophosphorylase 1
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133806 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133806 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133806 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003115 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003115 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003115 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003115 Rosetta Predictions human pricing
XM_001072323 Rosetta Predictions rat pricing
XM_573497 Rosetta Predictions rat pricing
NM_133806 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085613 predicted 1491
2 SASI_Hs01_00085614 predicted 1414
3 SASI_Hs01_00085615 predicted 798
4 SASI_Hs01_00085616 predicted 1682
5 SASI_Hs02_00335085 predicted 544
6 SASI_Hs01_00085618 predicted 1502
7 SASI_Hs01_00085619 predicted 699
8 SASI_Hs01_00085620 predicted 1793
9 SASI_Hs01_00085622 predicted 1696
10 SASI_Hs02_00335086 predicted 1897
11 SASI_Hs01_00085617 predicted 846
12 SASI_Hs01_00085621 predicted 1739
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072323 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00338683 predicted 915
2 SASI_Rn02_00338684 predicted 1623
3 SASI_Rn02_00338685 predicted 746
4 SASI_Rn02_00338686 predicted 721
5 SASI_Rn02_00338687 predicted 1375
6 SASI_Rn02_00338688 predicted 802
7 SASI_Rn02_00338689 predicted 1722
8 SASI_Rn02_00338690 predicted 610
9 SASI_Rn02_00338691 predicted 1615
10 SASI_Rn02_00338692 predicted 1218
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573497 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400384 predicted 924
2 SASI_Rn02_00400385 predicted 1627
3 SASI_Rn02_00400386 predicted 746
4 SASI_Rn02_00400387 predicted 719
5 SASI_Rn02_00400388 predicted 1371
6 SASI_Rn02_00400389 predicted 801
7 SASI_Rn02_00400390 predicted 1716
8 SASI_Rn02_00400391 predicted 610
9 SASI_Rn02_00400392 predicted 1611
10 SASI_Rn02_00400393 predicted 1211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133806 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029300 predicted 569
2 SASI_Mm01_00029302 predicted 771
3 SASI_Mm01_00029303 predicted 954
4 SASI_Mm01_00029304 predicted 1639
5 SASI_Mm01_00029305 predicted 1744
6 SASI_Mm02_00338832 predicted 1120
7 SASI_Mm01_00029306 predicted 1248
8 SASI_Mm01_00029307 predicted 1653
9 SASI_Mm01_00029308 predicted 1405
10 SASI_Mm01_00029309 predicted 350
11 SASI_Mm01_00029301 predicted 1134
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133806
VALIDATED
UAP1 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acteylglucosamine pyrophosphorylase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133806.2-1950s1c1
Sequence:CCGGCCCAGATGACTGGAGTTCATTCTCGAGAATGAACTCCAGTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133806.2-1336s1c1
Sequence:CCGGGCACTTCATTAAGCCAGACAACTCGAGTTGTCTGGCTTAATGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133806.2-741s1c1
Sequence:CCGGGCGGCAGAACAATGGAATCAACTCGAGTTGATTCCATTGTTCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133806.2-1754s1c1
Sequence:CCGGCCGCTAATCATCGATGAGAATCTCGAGATTCTCATCGATGATTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133806.2-324s1c1
Sequence:CCGGCCCAGCAGGTAGAACTTTATACTCGAGTATAAAGTTCTACCTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133806.4-2004s21c1
Sequence:CCGGTCAACTCTCTGAAGGTCTTATCTCGAGATAAGACCTTCAGAGAGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133806.4-649s21c1
Sequence:CCGGCAGATTCAAGCAGAACGTATTCTCGAGAATACGTTCTGCTTGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133806.4-1709s21c1
Sequence:CCGGGAGAGGGCCTTGAAGGTTATGCTCGAGCATAACCTTCAAGGCCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133806
VALIDATED
UAP1 MISSION shRNA shRNA Plasmid DNA
UDP-N-acteylglucosamine pyrophosphorylase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133806.2-1950s1c1
Sequence:CCGGCCCAGATGACTGGAGTTCATTCTCGAGAATGAACTCCAGTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133806.2-1336s1c1
Sequence:CCGGGCACTTCATTAAGCCAGACAACTCGAGTTGTCTGGCTTAATGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133806.2-741s1c1
Sequence:CCGGGCGGCAGAACAATGGAATCAACTCGAGTTGATTCCATTGTTCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133806.2-1754s1c1
Sequence:CCGGCCGCTAATCATCGATGAGAATCTCGAGATTCTCATCGATGATTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133806.2-324s1c1
Sequence:CCGGCCCAGCAGGTAGAACTTTATACTCGAGTATAAAGTTCTACCTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133806.4-2004s21c1
Sequence:CCGGTCAACTCTCTGAAGGTCTTATCTCGAGATAAGACCTTCAGAGAGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133806.4-649s21c1
Sequence:CCGGCAGATTCAAGCAGAACGTATTCTCGAGAATACGTTCTGCTTGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133806.4-1709s21c1
Sequence:CCGGGAGAGGGCCTTGAAGGTTATGCTCGAGCATAACCTTCAAGGCCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133806
VALIDATED
UAP1 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acteylglucosamine pyrophosphorylase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133806.2-1950s1c1
Sequence:CCGGCCCAGATGACTGGAGTTCATTCTCGAGAATGAACTCCAGTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133806.2-1336s1c1
Sequence:CCGGGCACTTCATTAAGCCAGACAACTCGAGTTGTCTGGCTTAATGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133806.2-741s1c1
Sequence:CCGGGCGGCAGAACAATGGAATCAACTCGAGTTGATTCCATTGTTCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133806.2-1754s1c1
Sequence:CCGGCCGCTAATCATCGATGAGAATCTCGAGATTCTCATCGATGATTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133806.2-324s1c1
Sequence:CCGGCCCAGCAGGTAGAACTTTATACTCGAGTATAAAGTTCTACCTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133806.4-2004s21c1
Sequence:CCGGTCAACTCTCTGAAGGTCTTATCTCGAGATAAGACCTTCAGAGAGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133806.4-649s21c1
Sequence:CCGGCAGATTCAAGCAGAACGTATTCTCGAGAATACGTTCTGCTTGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133806.4-1709s21c1
Sequence:CCGGGAGAGGGCCTTGAAGGTTATGCTCGAGCATAACCTTCAAGGCCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003115
VALIDATED
UAP1 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acteylglucosamine pyrophosphorylase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_003115.3-1671s1c1
Sequence:CCGGGCCAATGATGTACCAATCCAACTCGAGTTGGATTGGTACATCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_003115.3-2015s1c1
Sequence:CCGGCCCAACTCATTGAAGGTCTTACTCGAGTAAGACCTTCAATGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_003115.3-1409s1c1
Sequence:CCGGGCCAGACAAACCCAATGGAATCTCGAGATTCCATTGGGTTTGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_003115.3-1672s1c1
Sequence:CCGGCCAATGATGTACCAATCCAATCTCGAGATTGGATTGGTACATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_003115.3-1410s1c1
Sequence:CCGGCCAGACAAACCCAATGGAATACTCGAGTATTCCATTGGGTTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003115.4-800s21c1
Sequence:CCGGATGCATTATTCCATGGTATATCTCGAGATATACCATGGAATAATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003115.4-2042s21c1
Sequence:CCGGCCCAACTCATTGAAGGTCTTACTCGAGTAAGACCTTCAATGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003115.4-1698s21c1
Sequence:CCGGGCCAATGATGTACCAATCCAACTCGAGTTGGATTGGTACATCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003115.4-1437s21c1
Sequence:CCGGCCAGACAAACCCAATGGAATACTCGAGTATTCCATTGGGTTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003115
VALIDATED
UAP1 MISSION shRNA shRNA Plasmid DNA
UDP-N-acteylglucosamine pyrophosphorylase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_003115.3-1671s1c1
Sequence:CCGGGCCAATGATGTACCAATCCAACTCGAGTTGGATTGGTACATCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_003115.3-2015s1c1
Sequence:CCGGCCCAACTCATTGAAGGTCTTACTCGAGTAAGACCTTCAATGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_003115.3-1409s1c1
Sequence:CCGGGCCAGACAAACCCAATGGAATCTCGAGATTCCATTGGGTTTGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_003115.3-1672s1c1
Sequence:CCGGCCAATGATGTACCAATCCAATCTCGAGATTGGATTGGTACATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_003115.3-1410s1c1
Sequence:CCGGCCAGACAAACCCAATGGAATACTCGAGTATTCCATTGGGTTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003115.4-800s21c1
Sequence:CCGGATGCATTATTCCATGGTATATCTCGAGATATACCATGGAATAATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003115.4-2042s21c1
Sequence:CCGGCCCAACTCATTGAAGGTCTTACTCGAGTAAGACCTTCAATGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003115.4-1698s21c1
Sequence:CCGGGCCAATGATGTACCAATCCAACTCGAGTTGGATTGGTACATCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003115.4-1437s21c1
Sequence:CCGGCCAGACAAACCCAATGGAATACTCGAGTATTCCATTGGGTTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003115
VALIDATED
UAP1 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acteylglucosamine pyrophosphorylase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_003115.3-1671s1c1
Sequence:CCGGGCCAATGATGTACCAATCCAACTCGAGTTGGATTGGTACATCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_003115.3-2015s1c1
Sequence:CCGGCCCAACTCATTGAAGGTCTTACTCGAGTAAGACCTTCAATGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_003115.3-1409s1c1
Sequence:CCGGGCCAGACAAACCCAATGGAATCTCGAGATTCCATTGGGTTTGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_003115.3-1672s1c1
Sequence:CCGGCCAATGATGTACCAATCCAATCTCGAGATTGGATTGGTACATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_003115.3-1410s1c1
Sequence:CCGGCCAGACAAACCCAATGGAATACTCGAGTATTCCATTGGGTTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003115.4-800s21c1
Sequence:CCGGATGCATTATTCCATGGTATATCTCGAGATATACCATGGAATAATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003115.4-2042s21c1
Sequence:CCGGCCCAACTCATTGAAGGTCTTACTCGAGTAAGACCTTCAATGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003115.4-1698s21c1
Sequence:CCGGGCCAATGATGTACCAATCCAACTCGAGTTGGATTGGTACATCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003115.4-1437s21c1
Sequence:CCGGCCAGACAAACCCAATGGAATACTCGAGTATTCCATTGGGTTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks