EMAIL THIS PAGE TO A FRIEND

UAP1L1

UDP-N-acteylglucosamine pyrophosphorylase 1-like 1

Synonyms: RP11-229P13.18
UniProtKB ID: Q3KQV9, A2AMJ8, Q5SPZ2, Q69YQ3, Q6ZR38
Gene ID:
Mouse(227620) UDP-N-acteylglucosamine pyrophosphorylase 1-like 1
Rat(296560) UDP-N-acteylglucosamine pyrophosphorylase 1-like 1
cow(100299558) UDP-N-acteylglucosamine pyrophosphorylase 1-like 1
naked mole-rat(101725267) UDP-N-acteylglucosamine pyrophosphorylase 1-like 1
domestic guinea pig(100731579) UDP-N-acteylglucosamine pyrophosphorylase 1-like 1
Zebrafish(393264) UDP-N-acteylglucosamine pyrophosphorylase 1, like 1
chicken(417295) UDP-N-acteylglucosamine pyrophosphorylase 1-like 1
Horse(100067752) UDP-N-acteylglucosamine pyrophosphorylase 1-like 1
domestic cat(101101095) UDP-N-acteylglucosamine pyrophosphorylase 1-like 1
dog(491239) UDP-N-acteylglucosamine pyrophosphorylase 1-like 1
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207309 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207309 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207309 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033293 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033293 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033293 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207309 Rosetta Predictions human pricing
NM_001134516 Rosetta Predictions rat pricing
NM_001033293 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207309 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086320 predicted 648
2 SASI_Hs01_00086322 predicted 603
3 SASI_Hs01_00086323 predicted 1713
4 SASI_Hs01_00086324 predicted 1010
5 SASI_Hs01_00086321 predicted 525
6 SASI_Hs01_00086325 predicted 1201
7 SASI_Hs01_00086326 predicted 1448
8 SASI_Hs01_00086327 predicted 1430
9 SASI_Hs01_00086328 predicted 763
10 SASI_Hs01_00086329 predicted 561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134516 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256649 predicted 819
2 SASI_Rn02_00256650 predicted 1051
3 SASI_Rn02_00256651 predicted 1140
4 SASI_Rn02_00256652 predicted 1183
5 SASI_Rn02_00256653 predicted 1242
6 SASI_Rn02_00256654 predicted 639
7 SASI_Rn02_00256655 predicted 1245
8 SASI_Rn02_00256656 predicted 1534
9 SASI_Rn02_00256657 predicted 1465
10 SASI_Rn02_00256658 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033293 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131547 predicted 366
2 SASI_Mm01_00131548 predicted 1042
3 SASI_Mm01_00131549 predicted 988
4 SASI_Mm01_00131550 predicted 291
5 SASI_Mm01_00131551 predicted 1080
6 SASI_Mm01_00131552 predicted 1176
7 SASI_Mm01_00131553 predicted 1128
8 SASI_Mm01_00131555 predicted 1162
9 SASI_Mm01_00131556 predicted 521
10 SASI_Mm02_00288494 predicted 1197
11 SASI_Mm01_00131554 predicted 1186
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207309
UAP1L1 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acteylglucosamine pyrophosphorylase 1-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207309.2-1038s21c1
Sequence:CCGGTTCACCCGAGGCTTCCTTAAGCTCGAGCTTAAGGAAGCCTCGGGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207309.2-1198s21c1
Sequence:CCGGTCCGGTTTGCTAAGAACTTTGCTCGAGCAAAGTTCTTAGCAAACCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207309.2-662s21c1
Sequence:CCGGGGTTATCCTGGAGCGGAAAGACTCGAGTCTTTCCGCTCCAGGATAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207309.2-1136s21c1
Sequence:CCGGGAATCTGGTAAAGCCGCTAAACTCGAGTTTAGCGGCTTTACCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155966    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207309.1-1824s1c1
Sequence:CCGGCGAGCACTAGAAGCTGCATAACTCGAGTTATGCAGCTTCTAGTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207309.1-2737s1c1
Sequence:CCGGGCCCTTCTTACTGCAAACCATCTCGAGATGGTTTGCAGTAAGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207309.1-1259s1c1
Sequence:CCGGCATCTGTGAGATATCGCCCTTCTCGAGAAGGGCGATATCTCACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207309.1-839s1c1
Sequence:CCGGGCTGTACAATGCAGGCAACATCTCGAGATGTTGCCTGCATTGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207309.1-2994s1c1
Sequence:CCGGGCCTGGCTAATTCTTTGTATTCTCGAGAATACAAAGAATTAGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207309
UAP1L1 MISSION shRNA shRNA Plasmid DNA
UDP-N-acteylglucosamine pyrophosphorylase 1-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207309.2-1038s21c1
Sequence:CCGGTTCACCCGAGGCTTCCTTAAGCTCGAGCTTAAGGAAGCCTCGGGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207309.2-1198s21c1
Sequence:CCGGTCCGGTTTGCTAAGAACTTTGCTCGAGCAAAGTTCTTAGCAAACCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207309.2-662s21c1
Sequence:CCGGGGTTATCCTGGAGCGGAAAGACTCGAGTCTTTCCGCTCCAGGATAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207309.2-1136s21c1
Sequence:CCGGGAATCTGGTAAAGCCGCTAAACTCGAGTTTAGCGGCTTTACCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155966    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207309.1-1824s1c1
Sequence:CCGGCGAGCACTAGAAGCTGCATAACTCGAGTTATGCAGCTTCTAGTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207309.1-2737s1c1
Sequence:CCGGGCCCTTCTTACTGCAAACCATCTCGAGATGGTTTGCAGTAAGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207309.1-1259s1c1
Sequence:CCGGCATCTGTGAGATATCGCCCTTCTCGAGAAGGGCGATATCTCACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207309.1-839s1c1
Sequence:CCGGGCTGTACAATGCAGGCAACATCTCGAGATGTTGCCTGCATTGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207309.1-2994s1c1
Sequence:CCGGGCCTGGCTAATTCTTTGTATTCTCGAGAATACAAAGAATTAGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207309
UAP1L1 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acteylglucosamine pyrophosphorylase 1-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207309.2-1038s21c1
Sequence:CCGGTTCACCCGAGGCTTCCTTAAGCTCGAGCTTAAGGAAGCCTCGGGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207309.2-1198s21c1
Sequence:CCGGTCCGGTTTGCTAAGAACTTTGCTCGAGCAAAGTTCTTAGCAAACCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207309.2-662s21c1
Sequence:CCGGGGTTATCCTGGAGCGGAAAGACTCGAGTCTTTCCGCTCCAGGATAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207309.2-1136s21c1
Sequence:CCGGGAATCTGGTAAAGCCGCTAAACTCGAGTTTAGCGGCTTTACCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155966    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207309.1-1824s1c1
Sequence:CCGGCGAGCACTAGAAGCTGCATAACTCGAGTTATGCAGCTTCTAGTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207309.1-2737s1c1
Sequence:CCGGGCCCTTCTTACTGCAAACCATCTCGAGATGGTTTGCAGTAAGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207309.1-1259s1c1
Sequence:CCGGCATCTGTGAGATATCGCCCTTCTCGAGAAGGGCGATATCTCACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207309.1-839s1c1
Sequence:CCGGGCTGTACAATGCAGGCAACATCTCGAGATGTTGCCTGCATTGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207309.1-2994s1c1
Sequence:CCGGGCCTGGCTAATTCTTTGTATTCTCGAGAATACAAAGAATTAGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033293
VALIDATED
UAP1L1 MISSION shRNA Bacterial Glycerol Stock
UDP-N-acteylglucosamine pyrophosphorylase 1-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033293.2-995s21c1
Sequence:CCGGAGGCAACATCTGCAACCATTTCTCGAGAAATGGTTGCAGATGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033293.2-525s21c1
Sequence:CCGGTTTACCCTGGGACCCACAATCCTCGAGGATTGTGGGTCCCAGGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033293.2-1131s21c1
Sequence:CCGGCTAAGACCGAATGGGATAAAGCTCGAGCTTTATCCCATTCGGTCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033293.2-1413s21c1
Sequence:CCGGATCTCGCCCTTGGTGTCTTACCTCGAGGTAAGACACCAAGGGCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033293.2-295s21c1
Sequence:CCGGAGGAAGGTTTCCGACAGATTTCTCGAGAAATCTGTCGGAAACCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033293
VALIDATED
UAP1L1 MISSION shRNA shRNA Plasmid DNA
UDP-N-acteylglucosamine pyrophosphorylase 1-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033293.2-995s21c1
Sequence:CCGGAGGCAACATCTGCAACCATTTCTCGAGAAATGGTTGCAGATGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033293.2-525s21c1
Sequence:CCGGTTTACCCTGGGACCCACAATCCTCGAGGATTGTGGGTCCCAGGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033293.2-1131s21c1
Sequence:CCGGCTAAGACCGAATGGGATAAAGCTCGAGCTTTATCCCATTCGGTCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033293.2-1413s21c1
Sequence:CCGGATCTCGCCCTTGGTGTCTTACCTCGAGGTAAGACACCAAGGGCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033293.2-295s21c1
Sequence:CCGGAGGAAGGTTTCCGACAGATTTCTCGAGAAATCTGTCGGAAACCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033293
VALIDATED
UAP1L1 MISSION shRNA Lentiviral Transduction Particles
UDP-N-acteylglucosamine pyrophosphorylase 1-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033293.2-995s21c1
Sequence:CCGGAGGCAACATCTGCAACCATTTCTCGAGAAATGGTTGCAGATGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033293.2-525s21c1
Sequence:CCGGTTTACCCTGGGACCCACAATCCTCGAGGATTGTGGGTCCCAGGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033293.2-1131s21c1
Sequence:CCGGCTAAGACCGAATGGGATAAAGCTCGAGCTTTATCCCATTCGGTCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033293.2-1413s21c1
Sequence:CCGGATCTCGCCCTTGGTGTCTTACCTCGAGGTAAGACACCAAGGGCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033293.2-295s21c1
Sequence:CCGGAGGAAGGTTTCCGACAGATTTCTCGAGAAATCTGTCGGAAACCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks