EMAIL THIS PAGE TO A FRIEND

UBA1

ubiquitin-like modifier activating enzyme 1

Synonyms: A1S9 A1S9T A1ST AMCX1 GXP1 POC20 SMAX2 UBA1A UBE1 UBE1X
UniProtKB ID: P22314, Q5JRR8, Q96E13
Gene ID:
Human(7317) Summary: The protein encoded by this gene catalyzes the first step in ubiquitin conjugation to mark cellular proteins for degradation. This gene complements an X-linked mouse temperature-sensitive defect in DNA synthesis, and thus may function in DNA repair. It is part of a gene cluster on chromosome Xp11.23. Alternatively spliced transcript variants that encode the same protein have been described. [provided by RefSeq, Jul 2008]
Mouse(22201) ubiquitin-like modifier activating enzyme 1
Rat(314432) ubiquitin-like modifier activating enzyme 1
fruit fly(35998) Ubiquitin activating enzyme 1
Horse(100060792) ubiquitin-like modifier activating enzyme 1
domestic cat(101093248) ubiquitin-like modifier activating enzyme 1
dog(480896) ubiquitin-like modifier activating enzyme 1
Zebrafish(406335) ubiquitin-like modifier activating enzyme 1
Thale Cress(817562) ubiquitin-activating enzyme E1 1
cow(282869) ubiquitin-like modifier activating enzyme 1
sheep(101117052) ubiquitin-like modifier activating enzyme 1
sheep(443039) ubiquitin-like modifier activating enzyme 1
domestic guinea pig(100726349) ubiquitin-like modifier activating enzyme 1
naked mole-rat(101718119) ubiquitin-like modifier activating enzyme 1
Domestic Rabbit(100009225) ubiquitin-like modifier activating enzyme 1
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003334 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003334 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003334 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009457 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009457 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009457 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003334 Rosetta Predictions human pricing
NM_153280 Rosetta Predictions human pricing
NM_001014080 Rosetta Predictions rat pricing
NM_009457 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132789 predicted 3138
2 SASI_Hs01_00132790 predicted 1747
3 SASI_Hs01_00132791 predicted 2675
4 SASI_Hs01_00132792 predicted 2812
5 SASI_Hs01_00132793 predicted 1109
6 SASI_Hs01_00132794 predicted 1474
7 SASI_Hs01_00132795 predicted 1725
8 SASI_Hs01_00132796 predicted 1740
9 SASI_Hs01_00132797 predicted 3268
10 SASI_Hs01_00132798 predicted 3118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153280 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035546 predicted 3060
2 SASI_Hs01_00035547 predicted 1674
3 SASI_Hs01_00035548 predicted 2599
4 SASI_Hs01_00035549 predicted 2737
5 SASI_Hs01_00035550 predicted 1036
6 SASI_Hs01_00035551 predicted 1400
7 SASI_Hs01_00035552 predicted 1657
8 SASI_Hs01_00035553 predicted 1664
9 SASI_Hs01_00035554 predicted 3196
10 SASI_Hs01_00035555 predicted 3049
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014080 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201500 predicted 2677
2 SASI_Rn01_00077103 predicted 2756
3 SASI_Rn01_00077104 predicted 2443
4 SASI_Rn01_00077105 predicted 1699
5 SASI_Rn01_00077106 predicted 2764
6 SASI_Rn01_00077107 predicted 281
7 SASI_Rn01_00077108 predicted 1422
8 SASI_Rn01_00077109 predicted 1518
9 SASI_Rn02_00201501 predicted 2404
10 SASI_Rn02_00201502 predicted 2919
11 SASI_Rn01_00077110 predicted 3030
12 SASI_Rn01_00077111 predicted 1318
13 SASI_Rn01_00077112 predicted 3223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009457 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316165 predicted 2605
2 SASI_Mm02_00316166 predicted 2375
3 SASI_Mm02_00316167 predicted 214
4 SASI_Mm02_00316168 predicted 1404
5 SASI_Mm02_00316169 predicted 2608
6 SASI_Mm02_00316170 predicted 1352
7 SASI_Mm02_00316171 predicted 2692
8 SASI_Mm02_00316172 predicted 1240
9 SASI_Mm02_00316173 predicted 1470
10 SASI_Mm02_00316174 predicted 926
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003334
VALIDATED
UBA1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-like modifier activating enzyme 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003334.x-1691s1c1
Sequence:CCGGCCTGGGATGTCACGAAGTTAACTCGAGTTAACTTCGTGACATCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003334.x-3449s1c1
Sequence:CCGGCCACTGCCTTCTACCTTGTTTCTCGAGAAACAAGGTAGAAGGCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003334.x-3075s1c1
Sequence:CCGGGCACAAATTAGAGATCACCATCTCGAGATGGTGATCTCTAATTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_003334.3-1063s21c1
Sequence:CCGGCTCCAACTTCTCCGACTACATCTCGAGATGTAGTCGGAGAAGTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003334.3-1785s21c1
Sequence:CCGGCCTGGGATGTCACGAAGTTAACTCGAGTTAACTTCGTGACATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003334.3-3169s21c1
Sequence:CCGGGCACAAATTAGAGATCACCATCTCGAGATGGTGATCTCTAATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003334.3-876s21c1
Sequence:CCGGGTGCTATGGTTTCTATGGTTACTCGAGTAACCATAGAAACCATAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003334.3-3543s21c1
Sequence:CCGGCCACTGCCTTCTACCTTGTTTCTCGAGAAACAAGGTAGAAGGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003334
VALIDATED
UBA1 MISSION shRNA shRNA Plasmid DNA
ubiquitin-like modifier activating enzyme 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003334.x-1691s1c1
Sequence:CCGGCCTGGGATGTCACGAAGTTAACTCGAGTTAACTTCGTGACATCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003334.x-3449s1c1
Sequence:CCGGCCACTGCCTTCTACCTTGTTTCTCGAGAAACAAGGTAGAAGGCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003334.x-3075s1c1
Sequence:CCGGGCACAAATTAGAGATCACCATCTCGAGATGGTGATCTCTAATTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_003334.3-1063s21c1
Sequence:CCGGCTCCAACTTCTCCGACTACATCTCGAGATGTAGTCGGAGAAGTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003334.3-1785s21c1
Sequence:CCGGCCTGGGATGTCACGAAGTTAACTCGAGTTAACTTCGTGACATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003334.3-3169s21c1
Sequence:CCGGGCACAAATTAGAGATCACCATCTCGAGATGGTGATCTCTAATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003334.3-876s21c1
Sequence:CCGGGTGCTATGGTTTCTATGGTTACTCGAGTAACCATAGAAACCATAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003334.3-3543s21c1
Sequence:CCGGCCACTGCCTTCTACCTTGTTTCTCGAGAAACAAGGTAGAAGGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003334
VALIDATED
UBA1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-like modifier activating enzyme 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003334.x-1691s1c1
Sequence:CCGGCCTGGGATGTCACGAAGTTAACTCGAGTTAACTTCGTGACATCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003334.x-3449s1c1
Sequence:CCGGCCACTGCCTTCTACCTTGTTTCTCGAGAAACAAGGTAGAAGGCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003334.x-3075s1c1
Sequence:CCGGGCACAAATTAGAGATCACCATCTCGAGATGGTGATCTCTAATTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_003334.3-1063s21c1
Sequence:CCGGCTCCAACTTCTCCGACTACATCTCGAGATGTAGTCGGAGAAGTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003334.3-1785s21c1
Sequence:CCGGCCTGGGATGTCACGAAGTTAACTCGAGTTAACTTCGTGACATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003334.3-3169s21c1
Sequence:CCGGGCACAAATTAGAGATCACCATCTCGAGATGGTGATCTCTAATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003334.3-876s21c1
Sequence:CCGGGTGCTATGGTTTCTATGGTTACTCGAGTAACCATAGAAACCATAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003334.3-3543s21c1
Sequence:CCGGCCACTGCCTTCTACCTTGTTTCTCGAGAAACAAGGTAGAAGGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009457
VALIDATED
UBA1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-like modifier activating enzyme 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009457.2-3421s1c1
Sequence:CCGGCCGCTGCTTTGTACCTTGTTTCTCGAGAAACAAGGTACAAAGCAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009457.2-2613s1c1
Sequence:CCGGCCAGACAAGTTACCCGGATTTCTCGAGAAATCCGGGTAACTTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009457.2-513s1c1
Sequence:CCGGGCTGAACTCAACAGCTATGTACTCGAGTACATAGCTGTTGAGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009457.2-1865s1c1
Sequence:CCGGCCGATGTGTGTACTATCGGAACTCGAGTTCCGATAGTACACACATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009457.2-352s1c1
Sequence:CCGGGCTTGGGTGTAGAAATTGCTACTCGAGTAGCAATTTCTACACCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009457.3-512s21c1
Sequence:CCGGGCTGAACTCAACAGCTATGTACTCGAGTACATAGCTGTTGAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009457.3-1864s21c1
Sequence:CCGGCCGATGTGTGTACTATCGGAACTCGAGTTCCGATAGTACACACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009457.3-2612s21c1
Sequence:CCGGCCAGACAAGTTACCCGGATTTCTCGAGAAATCCGGGTAACTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009457.3-351s21c1
Sequence:CCGGGCTTGGGTGTAGAAATTGCTACTCGAGTAGCAATTTCTACACCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009457
VALIDATED
UBA1 MISSION shRNA shRNA Plasmid DNA
ubiquitin-like modifier activating enzyme 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009457.2-3421s1c1
Sequence:CCGGCCGCTGCTTTGTACCTTGTTTCTCGAGAAACAAGGTACAAAGCAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009457.2-2613s1c1
Sequence:CCGGCCAGACAAGTTACCCGGATTTCTCGAGAAATCCGGGTAACTTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009457.2-513s1c1
Sequence:CCGGGCTGAACTCAACAGCTATGTACTCGAGTACATAGCTGTTGAGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009457.2-1865s1c1
Sequence:CCGGCCGATGTGTGTACTATCGGAACTCGAGTTCCGATAGTACACACATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009457.2-352s1c1
Sequence:CCGGGCTTGGGTGTAGAAATTGCTACTCGAGTAGCAATTTCTACACCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009457.3-512s21c1
Sequence:CCGGGCTGAACTCAACAGCTATGTACTCGAGTACATAGCTGTTGAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009457.3-1864s21c1
Sequence:CCGGCCGATGTGTGTACTATCGGAACTCGAGTTCCGATAGTACACACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009457.3-2612s21c1
Sequence:CCGGCCAGACAAGTTACCCGGATTTCTCGAGAAATCCGGGTAACTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009457.3-351s21c1
Sequence:CCGGGCTTGGGTGTAGAAATTGCTACTCGAGTAGCAATTTCTACACCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009457
VALIDATED
UBA1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-like modifier activating enzyme 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009457.2-3421s1c1
Sequence:CCGGCCGCTGCTTTGTACCTTGTTTCTCGAGAAACAAGGTACAAAGCAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009457.2-2613s1c1
Sequence:CCGGCCAGACAAGTTACCCGGATTTCTCGAGAAATCCGGGTAACTTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009457.2-513s1c1
Sequence:CCGGGCTGAACTCAACAGCTATGTACTCGAGTACATAGCTGTTGAGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009457.2-1865s1c1
Sequence:CCGGCCGATGTGTGTACTATCGGAACTCGAGTTCCGATAGTACACACATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009457.2-352s1c1
Sequence:CCGGGCTTGGGTGTAGAAATTGCTACTCGAGTAGCAATTTCTACACCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009457.3-512s21c1
Sequence:CCGGGCTGAACTCAACAGCTATGTACTCGAGTACATAGCTGTTGAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009457.3-1864s21c1
Sequence:CCGGCCGATGTGTGTACTATCGGAACTCGAGTTCCGATAGTACACACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009457.3-2612s21c1
Sequence:CCGGCCAGACAAGTTACCCGGATTTCTCGAGAAATCCGGGTAACTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009457.3-351s21c1
Sequence:CCGGGCTTGGGTGTAGAAATTGCTACTCGAGTAGCAATTTCTACACCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks