EMAIL THIS PAGE TO A FRIEND

UBA2

ubiquitin-like modifier activating enzyme 2

Synonyms: ARX SAE2
UniProtKB ID: Q9UBT2, O95605, Q59H87, Q6IBP6, Q9NTJ1, Q9UED2
Gene ID:
Human(10054) Summary: Posttranslational modification of proteins by the addition of the small protein SUMO (see SUMO1; MIM 601912), or sumoylation, regulates protein structure and intracellular localization. SAE1 (MIM 613294) and UBA2 form a heterodimer that functions as a SUMO-activating enzyme for the sumoylation of proteins (Okuma et al., 1999 [PubMed 9920803]
Mouse(50995) ubiquitin-like modifier activating enzyme 2
Rat(308508) ubiquitin-like modifier activating enzyme 2
cow(507005) ubiquitin-like modifier activating enzyme 2
sheep(101112668) ubiquitin-like modifier activating enzyme 2
domestic guinea pig(100719212) ubiquitin-like modifier activating enzyme 2
Domestic Rabbit(100355779) ubiquitin-like modifier activating enzyme 2
naked mole-rat(101719788) ubiquitin-like modifier activating enzyme 2
fruit fly(44496) Smt3 activating enzyme 2
Horse(100057234) ubiquitin-like modifier activating enzyme 2
domestic cat(101089562) ubiquitin-like modifier activating enzyme 2
dog(476490) ubiquitin-like modifier activating enzyme 2
chicken(415784) ubiquitin-like modifier activating enzyme 2
Zebrafish(406672) ubiquitin-like modifier activating enzyme 2
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
S7699 Anti-SAE2 (201-215) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
S7824 Anti-SAE2 (551-565) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1306998 ANTI-SAE2 (UBA2) (C-TERM E616) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB3500487 Anti-SAE2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
SAB1300514 Anti-UBA2 (C-term A600) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1300513 Anti-UBA2 (C-term E616) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1300146 Anti-UBA2 (N-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB1400373 Anti-UBA2 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
HPA041436 Anti-UBA2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4500027 Anti-UBA2, C-Terminal antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016682 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016682 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016682 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005499 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005499 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005499 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005499 Rosetta Predictions human pricing
NM_001100579 Rosetta Predictions rat pricing
NM_016682 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005499 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069072 predicted 1447
2 SASI_Hs01_00069073 predicted 1090
3 SASI_Hs02_00339700 predicted 616
4 SASI_Hs01_00069075 predicted 1257
5 SASI_Hs01_00069076 predicted 385
6 SASI_Hs01_00069077 predicted 403
7 SASI_Hs01_00069078 predicted 536
8 SASI_Hs01_00069079 predicted 995
9 SASI_Hs01_00069080 predicted 858
10 SASI_Hs01_00069081 predicted 1637
11 SASI_Hs01_00069074 predicted 1962
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100579 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210108 predicted 997
2 SASI_Rn02_00210109 predicted 1255
3 SASI_Rn02_00210110 predicted 1135
4 SASI_Rn02_00210111 predicted 1644
5 SASI_Rn02_00210112 predicted 385
6 SASI_Rn02_00210113 predicted 616
7 SASI_Rn02_00210114 predicted 199
8 SASI_Rn02_00210115 predicted 799
9 SASI_Rn02_00210116 predicted 1882
10 SASI_Rn02_00210117 predicted 1663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016682 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103675 predicted 751
2 SASI_Mm01_00103677 predicted 1199
3 SASI_Mm01_00103678 predicted 1155
4 SASI_Mm01_00103679 predicted 1077
5 SASI_Mm01_00103680 predicted 695
6 SASI_Mm02_00323332 predicted 296
7 SASI_Mm02_00323333 predicted 1785
8 SASI_Mm01_00103682 predicted 622
9 SASI_Mm01_00103683 predicted 946
10 SASI_Mm01_00103684 predicted 495
11 SASI_Mm01_00103676 predicted 411
12 SASI_Mm01_00103681 predicted 568
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016682
VALIDATED
UBA2 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-like modifier activating enzyme 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016682.1-2182s1c1
Sequence:CCGGCGCTGCAACCTGGGTATAAATCTCGAGATTTATACCCAGGTTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016682.1-315s1c1
Sequence:CCGGCCAGACTATAATGTGGAGTTTCTCGAGAAACTCCACATTATAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016682.1-1323s1c1
Sequence:CCGGCCCAACACCAACTGTTACGTTCTCGAGAACGTAACAGTTGGTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016682.1-553s1c1
Sequence:CCGGCGCCTTCAGAACCTATCCATTCTCGAGAATGGATAGGTTCTGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016682.1-1773s1c1
Sequence:CCGGGTGCTCATAGTTGATTCAGATCTCGAGATCTGAATCAACTATGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016682.2-1204s21c1
Sequence:CCGGGATAGTGTTGGAAGGATTAAACTCGAGTTTAATCCTTCCAACACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016682.2-1590s21c1
Sequence:CCGGATACTTTGCTGATCAACATTCCTCGAGGAATGTTGATCAGCAAAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016682.2-992s21c1
Sequence:CCGGGAGACTCTGCGAGTCCATTTACTCGAGTAAATGGACTCGCAGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016682.2-1089s21c1
Sequence:CCGGCAAACCTCAGGATGCACATTTCTCGAGAAATGTGCATCCTGAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016682.2-574s21c1
Sequence:CCGGCATCGTATGGGCCAAGTATTTCTCGAGAAATACTTGGCCCATACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016682
VALIDATED
UBA2 MISSION shRNA shRNA Plasmid DNA
ubiquitin-like modifier activating enzyme 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016682.1-2182s1c1
Sequence:CCGGCGCTGCAACCTGGGTATAAATCTCGAGATTTATACCCAGGTTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016682.1-315s1c1
Sequence:CCGGCCAGACTATAATGTGGAGTTTCTCGAGAAACTCCACATTATAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016682.1-1323s1c1
Sequence:CCGGCCCAACACCAACTGTTACGTTCTCGAGAACGTAACAGTTGGTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016682.1-553s1c1
Sequence:CCGGCGCCTTCAGAACCTATCCATTCTCGAGAATGGATAGGTTCTGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016682.1-1773s1c1
Sequence:CCGGGTGCTCATAGTTGATTCAGATCTCGAGATCTGAATCAACTATGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016682.2-1204s21c1
Sequence:CCGGGATAGTGTTGGAAGGATTAAACTCGAGTTTAATCCTTCCAACACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016682.2-1590s21c1
Sequence:CCGGATACTTTGCTGATCAACATTCCTCGAGGAATGTTGATCAGCAAAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016682.2-992s21c1
Sequence:CCGGGAGACTCTGCGAGTCCATTTACTCGAGTAAATGGACTCGCAGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016682.2-1089s21c1
Sequence:CCGGCAAACCTCAGGATGCACATTTCTCGAGAAATGTGCATCCTGAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016682.2-574s21c1
Sequence:CCGGCATCGTATGGGCCAAGTATTTCTCGAGAAATACTTGGCCCATACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016682
VALIDATED
UBA2 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-like modifier activating enzyme 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016682.1-2182s1c1
Sequence:CCGGCGCTGCAACCTGGGTATAAATCTCGAGATTTATACCCAGGTTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016682.1-315s1c1
Sequence:CCGGCCAGACTATAATGTGGAGTTTCTCGAGAAACTCCACATTATAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016682.1-1323s1c1
Sequence:CCGGCCCAACACCAACTGTTACGTTCTCGAGAACGTAACAGTTGGTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016682.1-553s1c1
Sequence:CCGGCGCCTTCAGAACCTATCCATTCTCGAGAATGGATAGGTTCTGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016682.1-1773s1c1
Sequence:CCGGGTGCTCATAGTTGATTCAGATCTCGAGATCTGAATCAACTATGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016682.2-1204s21c1
Sequence:CCGGGATAGTGTTGGAAGGATTAAACTCGAGTTTAATCCTTCCAACACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016682.2-1590s21c1
Sequence:CCGGATACTTTGCTGATCAACATTCCTCGAGGAATGTTGATCAGCAAAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016682.2-992s21c1
Sequence:CCGGGAGACTCTGCGAGTCCATTTACTCGAGTAAATGGACTCGCAGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016682.2-1089s21c1
Sequence:CCGGCAAACCTCAGGATGCACATTTCTCGAGAAATGTGCATCCTGAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016682.2-574s21c1
Sequence:CCGGCATCGTATGGGCCAAGTATTTCTCGAGAAATACTTGGCCCATACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005499
VALIDATED
UBA2 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-like modifier activating enzyme 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005499.1-2118s1c1
Sequence:CCGGGCTGTATTGAAAGTAGGAATACTCGAGTATTCCTACTTTCAATACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_005499.1-320s1c1
Sequence:CCGGCCTGACTATAATGTGGAATTTCTCGAGAAATTCCACATTATAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005499.1-383s1c1
Sequence:CCGGGCTGCCCGAAACCATGTTAATCTCGAGATTAACATGGTTTCGGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005499.1-1454s1c1
Sequence:CCGGGCACCAGATGTCCAAATTGAACTCGAGTTCAATTTGGACATCTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005499.2-2163s21c1
Sequence:CCGGGCTGTATTGAAAGTAGGAATACTCGAGTATTCCTACTTTCAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_005499.2-206s21c1
Sequence:CCGGCTGATTGATCTGGATACTATTCTCGAGAATAGTATCCAGATCAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_005499.2-1253s21c1
Sequence:CCGGGCTGGGTTGATAGTATTGGAACTCGAGTTCCAATACTATCAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005499.2-1499s21c1
Sequence:CCGGGCACCAGATGTCCAAATTGAACTCGAGTTCAATTTGGACATCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005499.2-786s21c1
Sequence:CCGGCTACTAAGGAATGGGCTAAATCTCGAGATTTAGCCCATTCCTTAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005499
VALIDATED
UBA2 MISSION shRNA shRNA Plasmid DNA
ubiquitin-like modifier activating enzyme 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005499.1-2118s1c1
Sequence:CCGGGCTGTATTGAAAGTAGGAATACTCGAGTATTCCTACTTTCAATACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_005499.1-320s1c1
Sequence:CCGGCCTGACTATAATGTGGAATTTCTCGAGAAATTCCACATTATAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005499.1-383s1c1
Sequence:CCGGGCTGCCCGAAACCATGTTAATCTCGAGATTAACATGGTTTCGGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005499.1-1454s1c1
Sequence:CCGGGCACCAGATGTCCAAATTGAACTCGAGTTCAATTTGGACATCTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005499.2-2163s21c1
Sequence:CCGGGCTGTATTGAAAGTAGGAATACTCGAGTATTCCTACTTTCAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_005499.2-206s21c1
Sequence:CCGGCTGATTGATCTGGATACTATTCTCGAGAATAGTATCCAGATCAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_005499.2-1253s21c1
Sequence:CCGGGCTGGGTTGATAGTATTGGAACTCGAGTTCCAATACTATCAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005499.2-1499s21c1
Sequence:CCGGGCACCAGATGTCCAAATTGAACTCGAGTTCAATTTGGACATCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005499.2-786s21c1
Sequence:CCGGCTACTAAGGAATGGGCTAAATCTCGAGATTTAGCCCATTCCTTAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005499
VALIDATED
UBA2 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-like modifier activating enzyme 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005499.1-2118s1c1
Sequence:CCGGGCTGTATTGAAAGTAGGAATACTCGAGTATTCCTACTTTCAATACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_005499.1-320s1c1
Sequence:CCGGCCTGACTATAATGTGGAATTTCTCGAGAAATTCCACATTATAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005499.1-383s1c1
Sequence:CCGGGCTGCCCGAAACCATGTTAATCTCGAGATTAACATGGTTTCGGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005499.1-1454s1c1
Sequence:CCGGGCACCAGATGTCCAAATTGAACTCGAGTTCAATTTGGACATCTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005499.2-2163s21c1
Sequence:CCGGGCTGTATTGAAAGTAGGAATACTCGAGTATTCCTACTTTCAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_005499.2-206s21c1
Sequence:CCGGCTGATTGATCTGGATACTATTCTCGAGAATAGTATCCAGATCAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_005499.2-1253s21c1
Sequence:CCGGGCTGGGTTGATAGTATTGGAACTCGAGTTCCAATACTATCAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005499.2-1499s21c1
Sequence:CCGGGCACCAGATGTCCAAATTGAACTCGAGTTCAATTTGGACATCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005499.2-786s21c1
Sequence:CCGGCTACTAAGGAATGGGCTAAATCTCGAGATTTAGCCCATTCCTTAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks