EMAIL THIS PAGE TO A FRIEND

UBA3

ubiquitin-like modifier activating enzyme 3

Synonyms: UBE1C hUBA3
UniProtKB ID: Q8TBC4, A6NLB5, A8K027, O76088, Q9NTU3
Gene ID:
Human(9039) Summary: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E1 ubiquitin-activating enzyme family. The encoded enzyme associates with AppBp1, an amyloid beta precursor protein binding protein, to form a heterodimer, and then the enzyme complex activates NEDD8, a ubiquitin-like protein, which regulates cell division, signaling and embryogenesis. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(22200) ubiquitin-like modifier activating enzyme 3
Rat(117553) ubiquitin-like modifier activating enzyme 3
fruit fly(36539) Ubiquitin activating enzyme 3
Zebrafish(406776) ubiquitin-like modifier activating enzyme 3
Horse(100053395) ubiquitin-like modifier activating enzyme 3
domestic cat(101090175) ubiquitin-like modifier activating enzyme 3
dog(476560) ubiquitin-like modifier activating enzyme 3
chicken(426073) ubiquitin-like modifier activating enzyme 3
domestic guinea pig(100720892) ubiquitin-like modifier activating enzyme 3
naked mole-rat(101716749) ubiquitin-like modifier activating enzyme 3
Domestic Rabbit(100343309) ubiquitin-like modifier activating enzyme 3
cow(512647) ubiquitin-like modifier activating enzyme 3
sheep(101116609) ubiquitin-like modifier activating enzyme 3
157 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011666 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011666 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011666 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003968 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003968 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003968 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003968 Rosetta Predictions human pricing
NM_198195 Rosetta Predictions human pricing
NM_198197 Rosetta Predictions human pricing
NM_057205 Rosetta Predictions rat pricing
NM_001111106 Rosetta Predictions mouse pricing
NM_011666 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003968 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336649 predicted 333
2 SASI_Hs01_00089339 predicted 1188
3 SASI_Hs01_00089340 predicted 763
4 SASI_Hs01_00089341 predicted 1020
5 SASI_Hs01_00089342 predicted 1253
6 SASI_Hs01_00089343 predicted 1490
7 SASI_Hs02_00336650 predicted 301
8 SASI_Hs01_00089344 predicted 531
9 SASI_Hs01_00089347 predicted 1051
10 SASI_Hs01_00089348 predicted 433
11 SASI_Hs01_00089345 predicted 766
12 SASI_Hs01_00089346 predicted 1186
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371733 predicted 289
2 SASI_Hs01_00076229 predicted 1144
3 SASI_Hs01_00076230 predicted 715
4 SASI_Hs01_00076231 predicted 972
5 SASI_Hs01_00076232 predicted 1206
6 SASI_Hs01_00076233 predicted 1448
7 SASI_Hs02_00371734 predicted 258
8 SASI_Hs01_00076234 predicted 494
9 SASI_Hs01_00076237 predicted 1015
10 SASI_Hs01_00076238 predicted 392
11 SASI_Hs01_00076235 predicted 715
12 SASI_Hs01_00076236 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198197 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085593 predicted 1065
2 SASI_Hs01_00085594 predicted 649
3 SASI_Hs01_00085595 predicted 902
4 SASI_Hs01_00085596 predicted 1129
5 SASI_Hs01_00085597 predicted 1368
6 SASI_Hs01_00085598 predicted 422
7 SASI_Hs01_00085599 predicted 640
8 SASI_Hs01_00085600 predicted 1071
9 SASI_Hs01_00085601 predicted 937
10 SASI_Hs01_00085602 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057205 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267158 predicted 1189
2 SASI_Rn01_00091631 predicted 278
3 SASI_Rn01_00091632 predicted 1150
4 SASI_Rn01_00091633 predicted 209
5 SASI_Rn02_00267159 predicted 1171
6 SASI_Rn01_00091634 predicted 707
7 SASI_Rn01_00091635 predicted 1132
8 SASI_Rn01_00091636 predicted 519
9 SASI_Rn02_00267160 predicted 762
10 SASI_Rn02_00267161 predicted 305
11 SASI_Rn01_00091630 predicted 1376
12 SASI_Rn01_00091637 predicted 1073
13 SASI_Rn01_00091638 predicted 497
14 SASI_Rn01_00091639 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111106 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306422 predicted 499
2 SASI_Mm02_00306423 predicted 321
3 SASI_Mm02_00306424 predicted 1280
4 SASI_Mm02_00306425 predicted 1057
5 SASI_Mm02_00306426 predicted 1074
6 SASI_Mm02_00306427 predicted 1274
7 SASI_Mm02_00306428 predicted 1278
8 SASI_Mm02_00306429 predicted 1108
9 SASI_Mm02_00306430 predicted 751
10 SASI_Mm02_00306431 predicted 787
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011666 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064094 predicted 544
2 SASI_Mm01_00064095 predicted 364
3 SASI_Mm01_00064096 predicted 1326
4 SASI_Mm01_00064097 predicted 1097
5 SASI_Mm01_00064098 predicted 1116
6 SASI_Mm01_00064099 predicted 1314
7 SASI_Mm02_00321178 predicted 1324
8 SASI_Mm01_00064100 predicted 1146
9 SASI_Mm01_00064101 predicted 794
10 SASI_Mm01_00064103 predicted 828
11 SASI_Mm01_00064102 predicted 502
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011666
VALIDATED
UBA3 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-like modifier activating enzyme 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011666.2-825s21c1
Sequence:CCGGCCCAGAACACTGTATCGAGTACTCGAGTACTCGATACAGTGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011666.2-517s21c1
Sequence:CCGGCCACATTTCAACAAGATACAACTCGAGTTGTATCTTGTTGAAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011666.2-1104s21c1
Sequence:CCGGCCTTAATAACTACCTGGTATTCTCGAGAATACCAGGTAGTTATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011666.2-546s21c1
Sequence:CCGGCGACACTTTCTACCGACAATTCTCGAGAATTGTCGGTAGAAAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011666.1-403s1c1
Sequence:CCGGCCACATTTCAACAAGATACAACTCGAGTTGTATCTTGTTGAAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011666.1-711s1c1
Sequence:CCGGCCCAGAACACTGTATCGAGTACTCGAGTACTCGATACAGTGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011666.1-990s1c1
Sequence:CCGGCCTTAATAACTACCTGGTATTCTCGAGAATACCAGGTAGTTATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011666.1-432s1c1
Sequence:CCGGCGACACTTTCTACCGACAATTCTCGAGAATTGTCGGTAGAAAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011666
VALIDATED
UBA3 MISSION shRNA shRNA Plasmid DNA
ubiquitin-like modifier activating enzyme 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011666.2-825s21c1
Sequence:CCGGCCCAGAACACTGTATCGAGTACTCGAGTACTCGATACAGTGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011666.2-517s21c1
Sequence:CCGGCCACATTTCAACAAGATACAACTCGAGTTGTATCTTGTTGAAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011666.2-1104s21c1
Sequence:CCGGCCTTAATAACTACCTGGTATTCTCGAGAATACCAGGTAGTTATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011666.2-546s21c1
Sequence:CCGGCGACACTTTCTACCGACAATTCTCGAGAATTGTCGGTAGAAAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011666.1-403s1c1
Sequence:CCGGCCACATTTCAACAAGATACAACTCGAGTTGTATCTTGTTGAAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011666.1-711s1c1
Sequence:CCGGCCCAGAACACTGTATCGAGTACTCGAGTACTCGATACAGTGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011666.1-990s1c1
Sequence:CCGGCCTTAATAACTACCTGGTATTCTCGAGAATACCAGGTAGTTATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011666.1-432s1c1
Sequence:CCGGCGACACTTTCTACCGACAATTCTCGAGAATTGTCGGTAGAAAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011666
VALIDATED
UBA3 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-like modifier activating enzyme 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011666.2-825s21c1
Sequence:CCGGCCCAGAACACTGTATCGAGTACTCGAGTACTCGATACAGTGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011666.2-517s21c1
Sequence:CCGGCCACATTTCAACAAGATACAACTCGAGTTGTATCTTGTTGAAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011666.2-1104s21c1
Sequence:CCGGCCTTAATAACTACCTGGTATTCTCGAGAATACCAGGTAGTTATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011666.2-546s21c1
Sequence:CCGGCGACACTTTCTACCGACAATTCTCGAGAATTGTCGGTAGAAAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011666.1-403s1c1
Sequence:CCGGCCACATTTCAACAAGATACAACTCGAGTTGTATCTTGTTGAAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011666.1-711s1c1
Sequence:CCGGCCCAGAACACTGTATCGAGTACTCGAGTACTCGATACAGTGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011666.1-990s1c1
Sequence:CCGGCCTTAATAACTACCTGGTATTCTCGAGAATACCAGGTAGTTATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011666.1-432s1c1
Sequence:CCGGCGACACTTTCTACCGACAATTCTCGAGAATTGTCGGTAGAAAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003968
VALIDATED
UBA3 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-like modifier activating enzyme 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000272812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003968.3-476s21c1
Sequence:CCGGCGACACTTTCTATCGACAATTCTCGAGAATTGTCGATAGAAAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003968.3-1817s21c1
Sequence:CCGGATCTGACATCTGGAGTATATTCTCGAGAATATACTCCAGATGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003968.3-1276s21c1
Sequence:CCGGCCTCTATTGAAGAACGAACAACTCGAGTTGTTCGTTCTTCAATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003968.3-700s21c1
Sequence:CCGGTTTATCCACCACAGGTTAATTCTCGAGAATTAACCTGTGGTGGATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003968.3-1374s21c1
Sequence:CCGGCCACAGACTGTACTATTCAAACTCGAGTTTGAATAGTACAGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003968.3-1276s1c1
Sequence:CCGGCCTCTATTGAAGAACGAACAACTCGAGTTGTTCGTTCTTCAATAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003968.3-1374s1c1
Sequence:CCGGCCACAGACTGTACTATTCAAACTCGAGTTTGAATAGTACAGTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003968.3-1644s1c1
Sequence:CCGGGAGCAAATGTATTGCTTCTTTCTCGAGAAAGAAGCAATACATTTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003968.3-476s1c1
Sequence:CCGGCGACACTTTCTATCGACAATTCTCGAGAATTGTCGATAGAAAGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003968.3-662s1c1
Sequence:CCGGGCCTGGAATGACTGCTTGTATCTCGAGATACAAGCAGTCATTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003968
VALIDATED
UBA3 MISSION shRNA shRNA Plasmid DNA
ubiquitin-like modifier activating enzyme 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000272812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003968.3-476s21c1
Sequence:CCGGCGACACTTTCTATCGACAATTCTCGAGAATTGTCGATAGAAAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003968.3-1817s21c1
Sequence:CCGGATCTGACATCTGGAGTATATTCTCGAGAATATACTCCAGATGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003968.3-1276s21c1
Sequence:CCGGCCTCTATTGAAGAACGAACAACTCGAGTTGTTCGTTCTTCAATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003968.3-700s21c1
Sequence:CCGGTTTATCCACCACAGGTTAATTCTCGAGAATTAACCTGTGGTGGATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003968.3-1374s21c1
Sequence:CCGGCCACAGACTGTACTATTCAAACTCGAGTTTGAATAGTACAGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003968.3-1276s1c1
Sequence:CCGGCCTCTATTGAAGAACGAACAACTCGAGTTGTTCGTTCTTCAATAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003968.3-1374s1c1
Sequence:CCGGCCACAGACTGTACTATTCAAACTCGAGTTTGAATAGTACAGTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003968.3-1644s1c1
Sequence:CCGGGAGCAAATGTATTGCTTCTTTCTCGAGAAAGAAGCAATACATTTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003968.3-476s1c1
Sequence:CCGGCGACACTTTCTATCGACAATTCTCGAGAATTGTCGATAGAAAGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003968.3-662s1c1
Sequence:CCGGGCCTGGAATGACTGCTTGTATCTCGAGATACAAGCAGTCATTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003968
VALIDATED
UBA3 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-like modifier activating enzyme 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000272812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003968.3-476s21c1
Sequence:CCGGCGACACTTTCTATCGACAATTCTCGAGAATTGTCGATAGAAAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003968.3-1817s21c1
Sequence:CCGGATCTGACATCTGGAGTATATTCTCGAGAATATACTCCAGATGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003968.3-1276s21c1
Sequence:CCGGCCTCTATTGAAGAACGAACAACTCGAGTTGTTCGTTCTTCAATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003968.3-700s21c1
Sequence:CCGGTTTATCCACCACAGGTTAATTCTCGAGAATTAACCTGTGGTGGATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003968.3-1374s21c1
Sequence:CCGGCCACAGACTGTACTATTCAAACTCGAGTTTGAATAGTACAGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003968.3-1276s1c1
Sequence:CCGGCCTCTATTGAAGAACGAACAACTCGAGTTGTTCGTTCTTCAATAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003968.3-1374s1c1
Sequence:CCGGCCACAGACTGTACTATTCAAACTCGAGTTTGAATAGTACAGTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003968.3-1644s1c1
Sequence:CCGGGAGCAAATGTATTGCTTCTTTCTCGAGAAAGAAGCAATACATTTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003968.3-476s1c1
Sequence:CCGGCGACACTTTCTATCGACAATTCTCGAGAATTGTCGATAGAAAGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003968.3-662s1c1
Sequence:CCGGGCCTGGAATGACTGCTTGTATCTCGAGATACAAGCAGTCATTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks