EMAIL THIS PAGE TO A FRIEND

UBA52

ubiquitin A-52 residue ribosomal protein fusion product 1

Synonyms: CEP52 HUBCEP52 L40 RPL40
Gene ID:
Human(7311) Summary: Ubiquitin is a highly conserved nuclear and cytoplasmic protein that has a major role in targeting cellular proteins for degradation by the 26S proteosome. It is also involved in the maintenance of chromatin structure, the regulation of gene expression, and the stress response. Ubiquitin is synthesized as a precursor protein consisting of either polyubiquitin chains or a single ubiquitin moiety fused to an unrelated protein. This gene encodes a fusion protein consisting of ubiquitin at the N terminus and ribosomal protein L40 at the C terminus, a C-terminal extension protein (CEP). Multiple processed pseudogenes derived from this gene are present in the genome. [provided by RefSeq, Jul 2008]
Mouse(22186) ubiquitin A-52 residue ribosomal protein fusion product 1
Rat(64156) ubiquitin A-52 residue ribosomal protein fusion product 1
Zebrafish(641289) ubiquitin A-52 residue ribosomal protein fusion product 1
chicken(395958) ubiquitin A-52 residue ribosomal protein fusion product 1
Horse(100071005) ubiquitin A-52 residue ribosomal protein fusion product 1
domestic cat(100144608) ubiquitin A-52 residue ribosomal protein fusion product 1
dog(403722) ubiquitin A-52 residue ribosomal protein fusion product 1
domestic guinea pig(100719482) ubiquitin A-52 residue ribosomal protein fusion product 1
naked mole-rat(101699951) ubiquitin A-52 residue ribosomal protein fusion product 1
cow(615199) ubiquitin A-52 residue ribosomal protein fusion product 1
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003333 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003333 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003333 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019883 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019883 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019883 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU223871 MISSION® esiRNA esiRNA targeting human UBA52 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033930 Rosetta Predictions human pricing
NM_003333 Rosetta Predictions human pricing
NM_031687 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033930 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178527 predicted 475
2 SASI_Hs02_00308112 predicted 714
3 SASI_Hs01_00178529 predicted 477
4 SASI_Hs01_00178530 predicted 380
5 SASI_Hs01_00178531 predicted 577
6 SASI_Hs01_00178532 predicted 442
7 SASI_Hs02_00308113 predicted 718
8 SASI_Hs02_00308114 predicted 594
9 SASI_Hs02_00308115 predicted 637
10 SASI_Hs02_00308116 predicted 646
11 SASI_Hs01_00178525 predicted 433
12 SASI_Hs01_00178526 predicted 408
13 SASI_Hs01_00178528 predicted 436
14 SASI_Hs01_00178533 predicted 416
15 SASI_Hs01_00178534 predicted 374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003333 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190409 predicted 458
2 SASI_Hs02_00335481 predicted 695
3 SASI_Hs01_00190411 predicted 451
4 SASI_Hs01_00190412 predicted 365
5 SASI_Hs01_00190413 predicted 558
6 SASI_Hs01_00190414 predicted 421
7 SASI_Hs02_00335482 predicted 693
8 SASI_Hs02_00335483 predicted 571
9 SASI_Hs02_00335484 predicted 619
10 SASI_Hs02_00335485 predicted 622
11 SASI_Hs01_00190407 predicted 407
12 SASI_Hs01_00190408 predicted 388
13 SASI_Hs01_00190410 predicted 406
14 SASI_Hs01_00190415 predicted 401
15 SASI_Hs01_00190416 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031687 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110148 predicted 257
2 SASI_Rn02_00265031 predicted 279
3 SASI_Rn01_00110149 predicted 252
4 SASI_Rn01_00110150 predicted 270
5 SASI_Rn01_00110151 predicted 277
6 SASI_Rn01_00110152 predicted 424
7 SASI_Rn01_00110153 predicted 361
8 SASI_Rn01_00110154 predicted 296
9 SASI_Rn01_00110155 predicted 173
10 SASI_Rn01_00110156 predicted 421
11 SASI_Rn01_00110157 predicted 167
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003333
VALIDATED
UBA52 MISSION shRNA Bacterial Glycerol Stock
ubiquitin A-52 residue ribosomal protein fusion product 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000272707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003333.3-422s21c1
Sequence:CCGGCCGCAAGAAGAAGTGTGGTCACTCGAGTGACCACACTTCTTCTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003333.3-455s21c1
Sequence:CCGGGCGTCCCAAGAAGAAGGTCAACTCGAGTTGACCTTCTTCTTGGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003333.3-443s21c1
Sequence:CCGGCACCAACAACCTGCGTCCCAACTCGAGTTGGGACGCAGGTTGTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003333.3-904s21c1
Sequence:CCGGAGAACGTTGATTCTCAAATTTCTCGAGAAATTTGAGAATCAACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003333.x-389s1c1
Sequence:CCGGCACCAACAACCTGCGTCCCAACTCGAGTTGGGACGCAGGTTGTTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003333.x-160s1c1
Sequence:CCGGAGCGTCTGATATTTGCCGGCACTCGAGTGCCGGCAAATATCAGACGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003333.x-161s1c1
Sequence:CCGGGCGTCTGATATTTGCCGGCAACTCGAGTTGCCGGCAAATATCAGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003333.x-368s1c1
Sequence:CCGGCCGCAAGAAGAAGTGTGGTCACTCGAGTGACCACACTTCTTCTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003333.x-401s1c1
Sequence:CCGGGCGTCCCAAGAAGAAGGTCAACTCGAGTTGACCTTCTTCTTGGGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003333
VALIDATED
UBA52 MISSION shRNA shRNA Plasmid DNA
ubiquitin A-52 residue ribosomal protein fusion product 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000272707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003333.3-422s21c1
Sequence:CCGGCCGCAAGAAGAAGTGTGGTCACTCGAGTGACCACACTTCTTCTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003333.3-455s21c1
Sequence:CCGGGCGTCCCAAGAAGAAGGTCAACTCGAGTTGACCTTCTTCTTGGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003333.3-443s21c1
Sequence:CCGGCACCAACAACCTGCGTCCCAACTCGAGTTGGGACGCAGGTTGTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003333.3-904s21c1
Sequence:CCGGAGAACGTTGATTCTCAAATTTCTCGAGAAATTTGAGAATCAACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003333.x-389s1c1
Sequence:CCGGCACCAACAACCTGCGTCCCAACTCGAGTTGGGACGCAGGTTGTTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003333.x-160s1c1
Sequence:CCGGAGCGTCTGATATTTGCCGGCACTCGAGTGCCGGCAAATATCAGACGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003333.x-161s1c1
Sequence:CCGGGCGTCTGATATTTGCCGGCAACTCGAGTTGCCGGCAAATATCAGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003333.x-368s1c1
Sequence:CCGGCCGCAAGAAGAAGTGTGGTCACTCGAGTGACCACACTTCTTCTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003333.x-401s1c1
Sequence:CCGGGCGTCCCAAGAAGAAGGTCAACTCGAGTTGACCTTCTTCTTGGGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003333
VALIDATED
UBA52 MISSION shRNA Lentiviral Transduction Particles
ubiquitin A-52 residue ribosomal protein fusion product 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000272707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003333.3-422s21c1
Sequence:CCGGCCGCAAGAAGAAGTGTGGTCACTCGAGTGACCACACTTCTTCTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003333.3-455s21c1
Sequence:CCGGGCGTCCCAAGAAGAAGGTCAACTCGAGTTGACCTTCTTCTTGGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003333.3-443s21c1
Sequence:CCGGCACCAACAACCTGCGTCCCAACTCGAGTTGGGACGCAGGTTGTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003333.3-904s21c1
Sequence:CCGGAGAACGTTGATTCTCAAATTTCTCGAGAAATTTGAGAATCAACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003333.x-389s1c1
Sequence:CCGGCACCAACAACCTGCGTCCCAACTCGAGTTGGGACGCAGGTTGTTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003333.x-160s1c1
Sequence:CCGGAGCGTCTGATATTTGCCGGCACTCGAGTGCCGGCAAATATCAGACGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003333.x-161s1c1
Sequence:CCGGGCGTCTGATATTTGCCGGCAACTCGAGTTGCCGGCAAATATCAGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003333.x-368s1c1
Sequence:CCGGCCGCAAGAAGAAGTGTGGTCACTCGAGTGACCACACTTCTTCTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003333.x-401s1c1
Sequence:CCGGGCGTCCCAAGAAGAAGGTCAACTCGAGTTGACCTTCTTCTTGGGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019883
UBA52 MISSION shRNA Bacterial Glycerol Stock
ubiquitin A-52 residue ribosomal protein fusion product 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019883.1-279s1c1
Sequence:CCGGCCAGAAGTACAACTGTGACAACTCGAGTTGTCACAGTTGTACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019883.1-103s1c1
Sequence:CCGGGCCAAGATCCAAGACAAGGAACTCGAGTTCCTTGTCTTGGATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019883.1-190s1c1
Sequence:CCGGTCCGACTACAACATCCAGAAACTCGAGTTTCTGGATGTTGTAGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019883.1-309s1c1
Sequence:CCGGCCGCAAGTGCTACGCACGCCTCTCGAGAGGCGTGCGTAGCACTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019883.1-90s1c1
Sequence:CCGGCGAGAATGTCAAGGCCAAGATCTCGAGATCTTGGCCTTGACATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019883
UBA52 MISSION shRNA shRNA Plasmid DNA
ubiquitin A-52 residue ribosomal protein fusion product 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019883.1-279s1c1
Sequence:CCGGCCAGAAGTACAACTGTGACAACTCGAGTTGTCACAGTTGTACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019883.1-103s1c1
Sequence:CCGGGCCAAGATCCAAGACAAGGAACTCGAGTTCCTTGTCTTGGATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019883.1-190s1c1
Sequence:CCGGTCCGACTACAACATCCAGAAACTCGAGTTTCTGGATGTTGTAGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019883.1-309s1c1
Sequence:CCGGCCGCAAGTGCTACGCACGCCTCTCGAGAGGCGTGCGTAGCACTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019883.1-90s1c1
Sequence:CCGGCGAGAATGTCAAGGCCAAGATCTCGAGATCTTGGCCTTGACATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019883
UBA52 MISSION shRNA Lentiviral Transduction Particles
ubiquitin A-52 residue ribosomal protein fusion product 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019883.1-279s1c1
Sequence:CCGGCCAGAAGTACAACTGTGACAACTCGAGTTGTCACAGTTGTACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019883.1-103s1c1
Sequence:CCGGGCCAAGATCCAAGACAAGGAACTCGAGTTCCTTGTCTTGGATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019883.1-190s1c1
Sequence:CCGGTCCGACTACAACATCCAGAAACTCGAGTTTCTGGATGTTGTAGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019883.1-309s1c1
Sequence:CCGGCCGCAAGTGCTACGCACGCCTCTCGAGAGGCGTGCGTAGCACTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019883.1-90s1c1
Sequence:CCGGCGAGAATGTCAAGGCCAAGATCTCGAGATCTTGGCCTTGACATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks