EMAIL THIS PAGE TO A FRIEND

UBA5

ubiquitin-like modifier activating enzyme 5

Synonyms: THIFP1 UBE1DC1
UniProtKB ID: Q9GZZ9, A6NJL3, D3DNC8, Q96ST1
Gene ID:
Human(79876) Summary: This gene encodes a member of the E1-like ubiquitin-activating enzyme family. This protein activates ubiquitin-fold modifier 1, a ubiquitin-like post-translational modifier protein, via the formation of a high-energy thioester bond. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. A pseudogene located on chromosome 1 has also been identified. [provided by RefSeq, Jul 2008]
Mouse(66663) ubiquitin-like modifier activating enzyme 5
Rat(300968) ubiquitin-like modifier activating enzyme 5
cow(509292) ubiquitin-like modifier activating enzyme 5
sheep(101118656) ubiquitin-like modifier activating enzyme 5
naked mole-rat(101712064) ubiquitin-like modifier activating enzyme 5
domestic guinea pig(100726590) ubiquitin-like modifier activating enzyme 5
Zebrafish(386712) ubiquitin-like modifier activating enzyme 5
Horse(100052911) ubiquitin-like modifier activating enzyme 5
domestic cat(101088609) ubiquitin-like modifier activating enzyme 5
dog(485664) ubiquitin-like modifier activating enzyme 5
chicken(414879) ubiquitin-like modifier activating enzyme 5
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025692 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025692 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025692 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198329 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198329 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198329 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024818 Rosetta Predictions human pricing
NM_198329 Rosetta Predictions human pricing
NM_001009669 Rosetta Predictions rat pricing
NM_025692 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024818 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119589 predicted 816
2 SASI_Hs01_00119590 predicted 1217
3 SASI_Hs01_00119592 predicted 932
4 SASI_Hs01_00119594 predicted 1091
5 SASI_Hs01_00119595 predicted 962
6 SASI_Hs01_00119596 predicted 832
7 SASI_Hs01_00119597 predicted 1270
8 SASI_Hs02_00357380 predicted 1120
9 SASI_Hs02_00357381 predicted 1203
10 SASI_Hs02_00357382 predicted 705
11 SASI_Hs01_00119588 predicted 1263
12 SASI_Hs01_00119591 predicted 652
13 SASI_Hs01_00119593 predicted 874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198329 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207132 predicted 641
2 SASI_Hs01_00207133 predicted 1037
3 SASI_Hs01_00207135 predicted 751
4 SASI_Hs01_00207137 predicted 906
5 SASI_Hs01_00207138 predicted 786
6 SASI_Hs01_00207139 predicted 656
7 SASI_Hs01_00207140 predicted 1092
8 SASI_Hs02_00371878 predicted 938
9 SASI_Hs02_00371879 predicted 1026
10 SASI_Hs02_00371880 predicted 534
11 SASI_Hs01_00207131 predicted 1607
12 SASI_Hs01_00207134 predicted 996
13 SASI_Hs01_00207136 predicted 1225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009669 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040356 predicted 331
2 SASI_Rn01_00040359 predicted 528
3 SASI_Rn01_00040360 predicted 1145
4 SASI_Rn01_00040361 predicted 549
5 SASI_Rn01_00040362 predicted 701
6 SASI_Rn01_00040363 predicted 689
7 SASI_Rn01_00040364 predicted 919
8 SASI_Rn01_00040365 predicted 395
9 SASI_Rn02_00199703 predicted 415
10 SASI_Rn02_00199704 predicted 581
11 SASI_Rn01_00040357 predicted 597
12 SASI_Rn01_00040358 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025692 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091761 predicted 857
2 SASI_Mm01_00091762 predicted 1191
3 SASI_Mm01_00091763 predicted 698
4 SASI_Mm02_00328853 predicted 1086
5 SASI_Mm01_00091764 predicted 354
6 SASI_Mm01_00091765 predicted 446
7 SASI_Mm01_00091766 predicted 378
8 SASI_Mm01_00091767 predicted 443
9 SASI_Mm01_00091768 predicted 727
10 SASI_Mm02_00328854 predicted 817
11 SASI_Mm01_00091769 predicted 748
12 SASI_Mm01_00091770 predicted 573
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025692
VALIDATED
UBA5 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-like modifier activating enzyme 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025692.1-1316s1c1
Sequence:CCGGGCTTCTGAAGTAACAGTGGAACTCGAGTTCCACTGTTACTTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025692.1-392s1c1
Sequence:CCGGGCTGTAGCAATAGTAGGTGTTCTCGAGAACACCTACTATTGCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025692.1-1257s1c1
Sequence:CCGGCCACCTTACCTGAAGGCATTACTCGAGTAATGCCTTCAGGTAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025692.1-863s1c1
Sequence:CCGGCCACTTGTAGTTGCTTCAAATCTCGAGATTTGAAGCAACTACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025692.1-341s1c1
Sequence:CCGGGCATTGAAACGGATGGGAATTCTCGAGAATTCCCATCCGTTTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025692.3-1257s21c1
Sequence:CCGGCCACCTTACCTGAAGGCATTACTCGAGTAATGCCTTCAGGTAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025692.3-1610s21c1
Sequence:CCGGCTACGGCTCTGGACGATAAATCTCGAGATTTATCGTCCAGAGCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025692.3-341s21c1
Sequence:CCGGGCATTGAAACGGATGGGAATTCTCGAGAATTCCCATCCGTTTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025692.3-863s21c1
Sequence:CCGGCCACTTGTAGTTGCTTCAAATCTCGAGATTTGAAGCAACTACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025692.3-724s21c1
Sequence:CCGGTGAAGCTCGAATGGCAATAAACTCGAGTTTATTGCCATTCGAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025692
VALIDATED
UBA5 MISSION shRNA shRNA Plasmid DNA
ubiquitin-like modifier activating enzyme 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025692.1-1316s1c1
Sequence:CCGGGCTTCTGAAGTAACAGTGGAACTCGAGTTCCACTGTTACTTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025692.1-392s1c1
Sequence:CCGGGCTGTAGCAATAGTAGGTGTTCTCGAGAACACCTACTATTGCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025692.1-1257s1c1
Sequence:CCGGCCACCTTACCTGAAGGCATTACTCGAGTAATGCCTTCAGGTAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025692.1-863s1c1
Sequence:CCGGCCACTTGTAGTTGCTTCAAATCTCGAGATTTGAAGCAACTACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025692.1-341s1c1
Sequence:CCGGGCATTGAAACGGATGGGAATTCTCGAGAATTCCCATCCGTTTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025692.3-1257s21c1
Sequence:CCGGCCACCTTACCTGAAGGCATTACTCGAGTAATGCCTTCAGGTAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025692.3-1610s21c1
Sequence:CCGGCTACGGCTCTGGACGATAAATCTCGAGATTTATCGTCCAGAGCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025692.3-341s21c1
Sequence:CCGGGCATTGAAACGGATGGGAATTCTCGAGAATTCCCATCCGTTTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025692.3-863s21c1
Sequence:CCGGCCACTTGTAGTTGCTTCAAATCTCGAGATTTGAAGCAACTACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025692.3-724s21c1
Sequence:CCGGTGAAGCTCGAATGGCAATAAACTCGAGTTTATTGCCATTCGAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025692
VALIDATED
UBA5 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-like modifier activating enzyme 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025692.1-1316s1c1
Sequence:CCGGGCTTCTGAAGTAACAGTGGAACTCGAGTTCCACTGTTACTTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025692.1-392s1c1
Sequence:CCGGGCTGTAGCAATAGTAGGTGTTCTCGAGAACACCTACTATTGCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025692.1-1257s1c1
Sequence:CCGGCCACCTTACCTGAAGGCATTACTCGAGTAATGCCTTCAGGTAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025692.1-863s1c1
Sequence:CCGGCCACTTGTAGTTGCTTCAAATCTCGAGATTTGAAGCAACTACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025692.1-341s1c1
Sequence:CCGGGCATTGAAACGGATGGGAATTCTCGAGAATTCCCATCCGTTTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025692.3-1257s21c1
Sequence:CCGGCCACCTTACCTGAAGGCATTACTCGAGTAATGCCTTCAGGTAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025692.3-1610s21c1
Sequence:CCGGCTACGGCTCTGGACGATAAATCTCGAGATTTATCGTCCAGAGCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025692.3-341s21c1
Sequence:CCGGGCATTGAAACGGATGGGAATTCTCGAGAATTCCCATCCGTTTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025692.3-863s21c1
Sequence:CCGGCCACTTGTAGTTGCTTCAAATCTCGAGATTTGAAGCAACTACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025692.3-724s21c1
Sequence:CCGGTGAAGCTCGAATGGCAATAAACTCGAGTTTATTGCCATTCGAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198329
VALIDATED
UBA5 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-like modifier activating enzyme 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008016    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198329.1-2499s1c1
Sequence:CCGGGCACCGAACAAGGAACAGAAACTCGAGTTTCTGTTCCTTGTTCGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198329.1-1166s1c1
Sequence:CCGGGCTTGTAATGAACTTGGACAACTCGAGTTGTCCAAGTTCATTACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198329.1-953s1c1
Sequence:CCGGGCAGGATTAAGTAAAGTTCAACTCGAGTTGAACTTTACTTAATCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198329.1-1487s1c1
Sequence:CCGGCCTCAGTGTGATGACAGAAATCTCGAGATTTCTGTCATCACACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198329.1-1547s1c1
Sequence:CCGGGCACTGCCTAAACAAGAGGTTCTCGAGAACCTCTTGTTTAGGCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198329.2-1358s21c1
Sequence:CCGGACTTAGGGCAACATTAATTAACTCGAGTTAATTAATGTTGCCCTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198329.2-461s21c1
Sequence:CCGGCATACTCTGAGGAACATTAATCTCGAGATTAATGTTCCTCAGAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198329.2-278s21c1
Sequence:CCGGCGTACCTTTGCCGTAGCAATACTCGAGTATTGCTACGGCAAAGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198329
VALIDATED
UBA5 MISSION shRNA shRNA Plasmid DNA
ubiquitin-like modifier activating enzyme 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008016    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198329.1-2499s1c1
Sequence:CCGGGCACCGAACAAGGAACAGAAACTCGAGTTTCTGTTCCTTGTTCGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198329.1-1166s1c1
Sequence:CCGGGCTTGTAATGAACTTGGACAACTCGAGTTGTCCAAGTTCATTACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198329.1-953s1c1
Sequence:CCGGGCAGGATTAAGTAAAGTTCAACTCGAGTTGAACTTTACTTAATCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198329.1-1487s1c1
Sequence:CCGGCCTCAGTGTGATGACAGAAATCTCGAGATTTCTGTCATCACACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198329.1-1547s1c1
Sequence:CCGGGCACTGCCTAAACAAGAGGTTCTCGAGAACCTCTTGTTTAGGCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198329.2-1358s21c1
Sequence:CCGGACTTAGGGCAACATTAATTAACTCGAGTTAATTAATGTTGCCCTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198329.2-461s21c1
Sequence:CCGGCATACTCTGAGGAACATTAATCTCGAGATTAATGTTCCTCAGAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198329.2-278s21c1
Sequence:CCGGCGTACCTTTGCCGTAGCAATACTCGAGTATTGCTACGGCAAAGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198329
VALIDATED
UBA5 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-like modifier activating enzyme 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008016    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198329.1-2499s1c1
Sequence:CCGGGCACCGAACAAGGAACAGAAACTCGAGTTTCTGTTCCTTGTTCGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198329.1-1166s1c1
Sequence:CCGGGCTTGTAATGAACTTGGACAACTCGAGTTGTCCAAGTTCATTACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198329.1-953s1c1
Sequence:CCGGGCAGGATTAAGTAAAGTTCAACTCGAGTTGAACTTTACTTAATCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198329.1-1487s1c1
Sequence:CCGGCCTCAGTGTGATGACAGAAATCTCGAGATTTCTGTCATCACACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198329.1-1547s1c1
Sequence:CCGGGCACTGCCTAAACAAGAGGTTCTCGAGAACCTCTTGTTTAGGCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198329.2-1358s21c1
Sequence:CCGGACTTAGGGCAACATTAATTAACTCGAGTTAATTAATGTTGCCCTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198329.2-461s21c1
Sequence:CCGGCATACTCTGAGGAACATTAATCTCGAGATTAATGTTCCTCAGAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198329.2-278s21c1
Sequence:CCGGCGTACCTTTGCCGTAGCAATACTCGAGTATTGCTACGGCAAAGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks