EMAIL THIS PAGE TO A FRIEND

UBA6

ubiquitin-like modifier activating enzyme 6

Synonyms: E1-L2 MOP-4 UBE1L2
Gene ID:
Human(55236) Summary: Modification of proteins with ubiquitin (UBB; MIM 191339) or ubiquitin-like proteins controls many signaling networks and requires a ubiquitin-activating enzyme (E1), a ubiquitin conjugating enzyme (E2), and a ubiquitin protein ligase (E3). UBE1L2 is an E1 enzyme that initiates the activation and conjugation of ubiquitin-like proteins (Jin et al., 2007 [PubMed 17597759]
Mouse(231380) ubiquitin-like modifier activating enzyme 6
Rat(305268) ubiquitin-like modifier activating enzyme 6
chicken(422655) ubiquitin-like modifier activating enzyme 6
dog(475160) ubiquitin-like modifier activating enzyme 6
domestic cat(101089102) ubiquitin-like modifier activating enzyme 6
Horse(100067272) ubiquitin-like modifier activating enzyme 6
cow(518834) ubiquitin-like modifier activating enzyme 6
sheep(101115278) ubiquitin-like modifier activating enzyme 6
naked mole-rat(101704912) ubiquitin-like modifier activating enzyme 6
domestic guinea pig(100720312) ubiquitin-like modifier activating enzyme 6
207 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018227 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018227 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018227 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172712 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172712 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172712 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018227 Rosetta Predictions human pricing
NM_001107213 Rosetta Predictions rat pricing
NM_172712 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351542 predicted 2773
2 SASI_Hs02_00351543 predicted 2571
3 SASI_Hs01_00175307 predicted 2179
4 SASI_Hs01_00175308 predicted 2476
5 SASI_Hs02_00351544 predicted 1848
6 SASI_Hs01_00175310 predicted 2856
7 SASI_Hs01_00175311 predicted 3031
8 SASI_Hs01_00175313 predicted 1788
9 SASI_Hs01_00175314 predicted 3099
10 SASI_Hs02_00351545 predicted 1526
11 SASI_Hs01_00175306 predicted 493
12 SASI_Hs01_00175309 predicted 326
13 SASI_Hs01_00175312 predicted 1839
14 SASI_Hs01_00175315 predicted 3090
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107213 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226625 predicted 2000
2 SASI_Rn02_00226626 predicted 779
3 SASI_Rn02_00226627 predicted 1019
4 SASI_Rn02_00226628 predicted 316
5 SASI_Rn02_00226629 predicted 1865
6 SASI_Rn02_00226630 predicted 2442
7 SASI_Rn02_00226631 predicted 828
8 SASI_Rn02_00226632 predicted 2149
9 SASI_Rn02_00226633 predicted 1960
10 SASI_Rn02_00226634 predicted 3118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172712 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092580 predicted 726
2 SASI_Mm01_00092582 predicted 1813
3 SASI_Mm01_00092583 predicted 1672
4 SASI_Mm01_00092585 predicted 771
5 SASI_Mm01_00092587 predicted 960
6 SASI_Mm01_00092588 predicted 1012
7 SASI_Mm01_00092589 predicted 2559
8 SASI_Mm02_00344488 predicted 3144
9 SASI_Mm02_00344489 predicted 1910
10 SASI_Mm02_00344490 predicted 247
11 SASI_Mm01_00092581 predicted 1440
12 SASI_Mm01_00092584 predicted 751
13 SASI_Mm01_00092586 predicted 3073
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018227
VALIDATED
UBA6 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-like modifier activating enzyme 6
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007707    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018227.3-3881s1c1
Sequence:CCGGGCTCTTAGAGAATCCGTGAATCTCGAGATTCACGGATTCTCTAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018227.3-514s1c1
Sequence:CCGGCCATTGCAGAAGAAGATCAATCTCGAGATTGATCTTCTTCTGCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018227.3-2187s1c1
Sequence:CCGGCCCTCTTGACATACGATTAAACTCGAGTTTAATCGTATGTCAAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018227.3-1285s1c1
Sequence:CCGGGCAGATATTGTTGAATCACTACTCGAGTAGTGATTCAACAATATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018227.3-1915s1c1
Sequence:CCGGGCTGCTATTGAACACACCATACTCGAGTATGGTGTGTTCAATAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018227.5-907s21c1
Sequence:CCGGAGGCATAGCTGTCCAAGTTAACTCGAGTTAACTTGGACAGCTATGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018227.5-839s21c1
Sequence:CCGGATAACGGTGATATCGCCATTTCTCGAGAAATGGCGATATCACCGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018227.5-881s21c1
Sequence:CCGGACAGAACTGGAACCATATTTACTCGAGTAAATATGGTTCCAGTTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018227.5-2838s21c1
Sequence:CCGGCCATTCCAATTGTAGTATTTACTCGAGTAAATACTACAATTGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018227.5-812s21c1
Sequence:CCGGACAGGTTTAAATGGATCTATACTCGAGTATAGATCCATTTAAACCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018227.5-3711s21c1
Sequence:CCGGGTGGATGAAGGGTGGATATTTCTCGAGAAATATCCACCCTTCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018227
VALIDATED
UBA6 MISSION shRNA shRNA Plasmid DNA
ubiquitin-like modifier activating enzyme 6
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007707    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018227.3-3881s1c1
Sequence:CCGGGCTCTTAGAGAATCCGTGAATCTCGAGATTCACGGATTCTCTAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018227.3-514s1c1
Sequence:CCGGCCATTGCAGAAGAAGATCAATCTCGAGATTGATCTTCTTCTGCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018227.3-2187s1c1
Sequence:CCGGCCCTCTTGACATACGATTAAACTCGAGTTTAATCGTATGTCAAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018227.3-1285s1c1
Sequence:CCGGGCAGATATTGTTGAATCACTACTCGAGTAGTGATTCAACAATATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018227.3-1915s1c1
Sequence:CCGGGCTGCTATTGAACACACCATACTCGAGTATGGTGTGTTCAATAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018227.5-907s21c1
Sequence:CCGGAGGCATAGCTGTCCAAGTTAACTCGAGTTAACTTGGACAGCTATGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018227.5-839s21c1
Sequence:CCGGATAACGGTGATATCGCCATTTCTCGAGAAATGGCGATATCACCGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018227.5-881s21c1
Sequence:CCGGACAGAACTGGAACCATATTTACTCGAGTAAATATGGTTCCAGTTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018227.5-2838s21c1
Sequence:CCGGCCATTCCAATTGTAGTATTTACTCGAGTAAATACTACAATTGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018227.5-812s21c1
Sequence:CCGGACAGGTTTAAATGGATCTATACTCGAGTATAGATCCATTTAAACCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018227.5-3711s21c1
Sequence:CCGGGTGGATGAAGGGTGGATATTTCTCGAGAAATATCCACCCTTCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018227
VALIDATED
UBA6 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-like modifier activating enzyme 6
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007707    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018227.3-3881s1c1
Sequence:CCGGGCTCTTAGAGAATCCGTGAATCTCGAGATTCACGGATTCTCTAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018227.3-514s1c1
Sequence:CCGGCCATTGCAGAAGAAGATCAATCTCGAGATTGATCTTCTTCTGCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018227.3-2187s1c1
Sequence:CCGGCCCTCTTGACATACGATTAAACTCGAGTTTAATCGTATGTCAAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018227.3-1285s1c1
Sequence:CCGGGCAGATATTGTTGAATCACTACTCGAGTAGTGATTCAACAATATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018227.3-1915s1c1
Sequence:CCGGGCTGCTATTGAACACACCATACTCGAGTATGGTGTGTTCAATAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018227.5-907s21c1
Sequence:CCGGAGGCATAGCTGTCCAAGTTAACTCGAGTTAACTTGGACAGCTATGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018227.5-839s21c1
Sequence:CCGGATAACGGTGATATCGCCATTTCTCGAGAAATGGCGATATCACCGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018227.5-881s21c1
Sequence:CCGGACAGAACTGGAACCATATTTACTCGAGTAAATATGGTTCCAGTTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018227.5-2838s21c1
Sequence:CCGGCCATTCCAATTGTAGTATTTACTCGAGTAAATACTACAATTGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018227.5-812s21c1
Sequence:CCGGACAGGTTTAAATGGATCTATACTCGAGTATAGATCCATTTAAACCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018227.5-3711s21c1
Sequence:CCGGGTGGATGAAGGGTGGATATTTCTCGAGAAATATCCACCCTTCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172712
VALIDATED
UBA6 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-like modifier activating enzyme 6
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172712.2-4282s1c1
Sequence:CCGGCGCATTCTAAACAAGTGCTTACTCGAGTAAGCACTTGTTTAGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172712.2-538s1c1
Sequence:CCGGGCCCTCCAATTAAGTTCATTACTCGAGTAATGAACTTAATTGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172712.2-2790s1c1
Sequence:CCGGGCCATTCCAATAATAGTGTTTCTCGAGAAACACTATTATTGGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172712.2-2095s1c1
Sequence:CCGGCCCAGTGTGTAGAGTTAGCAACTCGAGTTGCTAACTCTACACACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172712.2-681s1c1
Sequence:CCGGCCAGGTATTGTCACTTGCCTTCTCGAGAAGGCAAGTGACAATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172712.2-3179s21c1
Sequence:CCGGAGATACTCCAGCACTACTTTACTCGAGTAAAGTAGTGCTGGAGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172712.2-255s21c1
Sequence:CCGGGGGATTAAGGCCCTAACAATTCTCGAGAATTGTTAGGGCCTTAATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172712
VALIDATED
UBA6 MISSION shRNA shRNA Plasmid DNA
ubiquitin-like modifier activating enzyme 6
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172712.2-4282s1c1
Sequence:CCGGCGCATTCTAAACAAGTGCTTACTCGAGTAAGCACTTGTTTAGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172712.2-538s1c1
Sequence:CCGGGCCCTCCAATTAAGTTCATTACTCGAGTAATGAACTTAATTGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172712.2-2790s1c1
Sequence:CCGGGCCATTCCAATAATAGTGTTTCTCGAGAAACACTATTATTGGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172712.2-2095s1c1
Sequence:CCGGCCCAGTGTGTAGAGTTAGCAACTCGAGTTGCTAACTCTACACACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172712.2-681s1c1
Sequence:CCGGCCAGGTATTGTCACTTGCCTTCTCGAGAAGGCAAGTGACAATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172712.2-3179s21c1
Sequence:CCGGAGATACTCCAGCACTACTTTACTCGAGTAAAGTAGTGCTGGAGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172712.2-255s21c1
Sequence:CCGGGGGATTAAGGCCCTAACAATTCTCGAGAATTGTTAGGGCCTTAATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172712
VALIDATED
UBA6 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-like modifier activating enzyme 6
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172712.2-4282s1c1
Sequence:CCGGCGCATTCTAAACAAGTGCTTACTCGAGTAAGCACTTGTTTAGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172712.2-538s1c1
Sequence:CCGGGCCCTCCAATTAAGTTCATTACTCGAGTAATGAACTTAATTGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172712.2-2790s1c1
Sequence:CCGGGCCATTCCAATAATAGTGTTTCTCGAGAAACACTATTATTGGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172712.2-2095s1c1
Sequence:CCGGCCCAGTGTGTAGAGTTAGCAACTCGAGTTGCTAACTCTACACACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172712.2-681s1c1
Sequence:CCGGCCAGGTATTGTCACTTGCCTTCTCGAGAAGGCAAGTGACAATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172712.2-3179s21c1
Sequence:CCGGAGATACTCCAGCACTACTTTACTCGAGTAAAGTAGTGCTGGAGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172712.2-255s21c1
Sequence:CCGGGGGATTAAGGCCCTAACAATTCTCGAGAATTGTTAGGGCCTTAATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks