EMAIL THIS PAGE TO A FRIEND

UBA7

ubiquitin-like modifier activating enzyme 7

Synonyms: D8 UBA1B UBE1L UBE2
UniProtKB ID: P41226, Q9BRB2
Gene ID:
Human(7318) Summary: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E1 ubiquitin-activating enzyme family. The encoded enzyme is a retinoid target that triggers promyelocytic leukemia (PML)/retinoic acid receptor alpha (RARalpha) degradation and apoptosis in acute promyelocytic leukemia, where it is involved in the conjugation of the ubiquitin-like interferon-stimulated gene 15 protein. [provided by RefSeq, Jul 2008]
Mouse(74153) ubiquitin-like modifier activating enzyme 7
Rat(301000) ubiquitin-like modifier activating enzyme 7
chicken(395178) ubiquitin-like modifier activating enzyme 7
domestic cat(101088821) ubiquitin-like modifier activating enzyme 7
Horse(100052809) ubiquitin-like modifier activating enzyme 7
dog(608118) ubiquitin-like modifier activating enzyme 7
domestic guinea pig(100731595) ubiquitin-like modifier activating enzyme 7
naked mole-rat(101719508) ubiquitin-like modifier activating enzyme 7
Domestic Rabbit(100338238) ubiquitin-like modifier activating enzyme 7
cow(497204) ubiquitin-like modifier activating enzyme 7
sheep(101123668) ubiquitin-like modifier activating enzyme 7
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003335 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003335 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003335 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023738 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023738 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023738 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134271 MISSION® esiRNA esiRNA human UBA7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003335 Rosetta Predictions human pricing
NM_001106856 Rosetta Predictions rat pricing
NM_023738 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209346 predicted 888
2 SASI_Hs01_00209347 predicted 1411
3 SASI_Hs01_00209348 predicted 2246
4 SASI_Hs02_00335486 predicted 1144
5 SASI_Hs01_00209349 predicted 811
6 SASI_Hs01_00209350 predicted 2246
7 SASI_Hs01_00209352 predicted 2690
8 SASI_Hs01_00209353 predicted 2074
9 SASI_Hs01_00209354 predicted 1888
10 SASI_Hs02_00335487 predicted 1880
11 SASI_Hs01_00209351 predicted 206
12 SASI_Hs01_00209355 predicted 1299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106856 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223076 predicted 1460
2 SASI_Rn02_00223077 predicted 2004
3 SASI_Rn02_00223078 predicted 1501
4 SASI_Rn02_00223079 predicted 858
5 SASI_Rn02_00223080 predicted 1038
6 SASI_Rn02_00223081 predicted 1755
7 SASI_Rn02_00223082 predicted 1176
8 SASI_Rn02_00223083 predicted 2078
9 SASI_Rn02_00223084 predicted 1375
10 SASI_Rn02_00223085 predicted 1836
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023738 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038475 predicted 1324
2 SASI_Mm01_00038476 predicted 1956
3 SASI_Mm01_00038477 predicted 2103
4 SASI_Mm01_00038478 predicted 2517
5 SASI_Mm01_00038479 predicted 2030
6 SASI_Mm01_00038480 predicted 2202
7 SASI_Mm01_00038481 predicted 2537
8 SASI_Mm01_00038482 predicted 989
9 SASI_Mm01_00038483 predicted 1189
10 SASI_Mm01_00038484 predicted 1129
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003335
UBA7 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-like modifier activating enzyme 7
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003335.2-794s21c1
Sequence:CCGGTGGTGACTTTCTCGGGAATTGCTCGAGCAATTCCCGAGAAAGTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003335.2-2701s21c1
Sequence:CCGGCGAATTGTGGGCCAGATTATCCTCGAGGATAATCTGGCCCACAATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003335.2-1408s1c1
Sequence:CCGGAGCCGCTATGATGGGCAAATTCTCGAGAATTTGCCCATCATAGCGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003335.2-2251s1c1
Sequence:CCGGCCTAATAAAGTGCTTGAGGATCTCGAGATCCTCAAGCACTTTATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003335.2-2019s1c1
Sequence:CCGGGCATGAGTTTGAAGAACTCTTCTCGAGAAGAGTTCTTCAAACTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003335.2-2822s1c1
Sequence:CCGGGCTACCTACATCTGGCTGAAACTCGAGTTTCAGCCAGATGTAGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003335.2-210s1c1
Sequence:CCGGGCTGTATTCAAGACAGCTGTACTCGAGTACAGCTGTCTTGAATACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003335
UBA7 MISSION shRNA shRNA Plasmid DNA
ubiquitin-like modifier activating enzyme 7
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003335.2-794s21c1
Sequence:CCGGTGGTGACTTTCTCGGGAATTGCTCGAGCAATTCCCGAGAAAGTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003335.2-2701s21c1
Sequence:CCGGCGAATTGTGGGCCAGATTATCCTCGAGGATAATCTGGCCCACAATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003335.2-1408s1c1
Sequence:CCGGAGCCGCTATGATGGGCAAATTCTCGAGAATTTGCCCATCATAGCGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003335.2-2251s1c1
Sequence:CCGGCCTAATAAAGTGCTTGAGGATCTCGAGATCCTCAAGCACTTTATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003335.2-2019s1c1
Sequence:CCGGGCATGAGTTTGAAGAACTCTTCTCGAGAAGAGTTCTTCAAACTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003335.2-2822s1c1
Sequence:CCGGGCTACCTACATCTGGCTGAAACTCGAGTTTCAGCCAGATGTAGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003335.2-210s1c1
Sequence:CCGGGCTGTATTCAAGACAGCTGTACTCGAGTACAGCTGTCTTGAATACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003335
UBA7 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-like modifier activating enzyme 7
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003335.2-794s21c1
Sequence:CCGGTGGTGACTTTCTCGGGAATTGCTCGAGCAATTCCCGAGAAAGTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003335.2-2701s21c1
Sequence:CCGGCGAATTGTGGGCCAGATTATCCTCGAGGATAATCTGGCCCACAATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003335.2-1408s1c1
Sequence:CCGGAGCCGCTATGATGGGCAAATTCTCGAGAATTTGCCCATCATAGCGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003335.2-2251s1c1
Sequence:CCGGCCTAATAAAGTGCTTGAGGATCTCGAGATCCTCAAGCACTTTATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003335.2-2019s1c1
Sequence:CCGGGCATGAGTTTGAAGAACTCTTCTCGAGAAGAGTTCTTCAAACTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003335.2-2822s1c1
Sequence:CCGGGCTACCTACATCTGGCTGAAACTCGAGTTTCAGCCAGATGTAGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003335.2-210s1c1
Sequence:CCGGGCTGTATTCAAGACAGCTGTACTCGAGTACAGCTGTCTTGAATACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023738
UBA7 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-like modifier activating enzyme 7
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023738.4-2724s21c1
Sequence:CCGGAGTCGTTCCGTGACCTGAAATCTCGAGATTTCAGGTCACGGAACGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023738.4-2506s21c1
Sequence:CCGTCTACGGGATCCTACCAGTTAACTCGAGTTAACTGGTAGGATCCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023738.4-1916s21c1
Sequence:CCGGCAGTGGGCCCAGGATCAATTTCTCGAGAAATTGATCCTGGGCCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023738.2-312s1c1
Sequence:CCGGGCTCAGTGTTTCCTTTCAGAACTCGAGTTCTGAAAGGAAACACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023738.2-739s1c1
Sequence:CCGGGCATGGTTGAACTCAACAGTTCTCGAGAACTGTTGAGTTCAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023738.2-1791s1c1
Sequence:CCGGGCTTCAGTGTTTGTGCCCTATCTCGAGATAGGGCACAAACACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023738.2-1479s1c1
Sequence:CCGGGCTGACATGGATTACATAGAACTCGAGTTCTATGTAATCCATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023738.2-2427s1c1
Sequence:CCGGCCTGTGCTGTTTGTGAAGGATCTCGAGATCCTTCACAAACAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023738
UBA7 MISSION shRNA shRNA Plasmid DNA
ubiquitin-like modifier activating enzyme 7
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023738.4-2724s21c1
Sequence:CCGGAGTCGTTCCGTGACCTGAAATCTCGAGATTTCAGGTCACGGAACGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023738.4-2506s21c1
Sequence:CCGTCTACGGGATCCTACCAGTTAACTCGAGTTAACTGGTAGGATCCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023738.4-1916s21c1
Sequence:CCGGCAGTGGGCCCAGGATCAATTTCTCGAGAAATTGATCCTGGGCCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023738.2-312s1c1
Sequence:CCGGGCTCAGTGTTTCCTTTCAGAACTCGAGTTCTGAAAGGAAACACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023738.2-739s1c1
Sequence:CCGGGCATGGTTGAACTCAACAGTTCTCGAGAACTGTTGAGTTCAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023738.2-1791s1c1
Sequence:CCGGGCTTCAGTGTTTGTGCCCTATCTCGAGATAGGGCACAAACACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023738.2-1479s1c1
Sequence:CCGGGCTGACATGGATTACATAGAACTCGAGTTCTATGTAATCCATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023738.2-2427s1c1
Sequence:CCGGCCTGTGCTGTTTGTGAAGGATCTCGAGATCCTTCACAAACAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023738
UBA7 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-like modifier activating enzyme 7
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023738.4-2724s21c1
Sequence:CCGGAGTCGTTCCGTGACCTGAAATCTCGAGATTTCAGGTCACGGAACGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023738.4-2506s21c1
Sequence:CCGTCTACGGGATCCTACCAGTTAACTCGAGTTAACTGGTAGGATCCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023738.4-1916s21c1
Sequence:CCGGCAGTGGGCCCAGGATCAATTTCTCGAGAAATTGATCCTGGGCCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023738.2-312s1c1
Sequence:CCGGGCTCAGTGTTTCCTTTCAGAACTCGAGTTCTGAAAGGAAACACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023738.2-739s1c1
Sequence:CCGGGCATGGTTGAACTCAACAGTTCTCGAGAACTGTTGAGTTCAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023738.2-1791s1c1
Sequence:CCGGGCTTCAGTGTTTGTGCCCTATCTCGAGATAGGGCACAAACACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023738.2-1479s1c1
Sequence:CCGGGCTGACATGGATTACATAGAACTCGAGTTCTATGTAATCCATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023738.2-2427s1c1
Sequence:CCGGCCTGTGCTGTTTGTGAAGGATCTCGAGATCCTTCACAAACAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks