EMAIL THIS PAGE TO A FRIEND

UBAC1

UBA domain containing 1

Synonyms: GBDR1 RP11-432J22.3 UBADC1
UniProtKB ID: Q9BSL1, O75500, Q9UMW7
Gene ID:
Mouse(98766) ubiquitin associated domain containing 1
Rat(362087) UBA domain containing 1
cow(613652) UBA domain containing 1
sheep(101111530) UBA domain containing 1
naked mole-rat(101720415) UBA domain containing 1
domestic guinea pig(100722364) UBA domain containing 1
Zebrafish(795038) UBA domain containing 1
domestic cat(101091911) UBA domain containing 1
dog(491256) UBA domain containing 1
chicken(427754) UBA domain containing 1
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016172 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016172 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016172 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133835 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133835 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133835 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016172 Rosetta Predictions human pricing
NM_001007742 Rosetta Predictions rat pricing
NM_133835 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058189 predicted 473
2 SASI_Hs01_00058190 predicted 1627
3 SASI_Hs01_00058191 predicted 658
4 SASI_Hs01_00058192 predicted 1028
5 SASI_Hs01_00058194 predicted 555
6 SASI_Hs01_00058195 predicted 1167
7 SASI_Hs01_00058196 predicted 1145
8 SASI_Hs01_00058197 predicted 1134
9 SASI_Hs01_00058198 predicted 1401
10 SASI_Hs02_00348985 predicted 1436
11 SASI_Hs01_00058193 predicted 1573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007742 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064643 predicted 619
2 SASI_Rn01_00064644 predicted 677
3 SASI_Rn01_00064645 predicted 1273
4 SASI_Rn02_00198932 predicted 1262
5 SASI_Rn01_00064646 predicted 857
6 SASI_Rn01_00064647 predicted 520
7 SASI_Rn01_00064649 predicted 349
8 SASI_Rn02_00198933 predicted 668
9 SASI_Rn01_00064650 predicted 1381
10 SASI_Rn01_00064651 predicted 1304
11 SASI_Rn01_00064642 predicted 1274
12 SASI_Rn01_00064648 predicted 680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133835 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338871 predicted 713
2 SASI_Mm02_00338872 predicted 1277
3 SASI_Mm02_00338873 predicted 688
4 SASI_Mm02_00338874 predicted 625
5 SASI_Mm02_00338875 predicted 1286
6 SASI_Mm02_00338876 predicted 863
7 SASI_Mm01_00172088 predicted 299
8 SASI_Mm01_00172089 predicted 357
9 SASI_Mm01_00172085 predicted 674
10 SASI_Mm02_00338877 predicted 659
11 SASI_Mm01_00172084 predicted 1070
12 SASI_Mm01_00172086 predicted 1321
13 SASI_Mm01_00172087 predicted 783
14 SASI_Mm01_00172090 predicted 362
15 SASI_Mm01_00172091 predicted 195
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016172
VALIDATED
UBAC1 MISSION shRNA Bacterial Glycerol Stock
UBA domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016172.1-440s1c1
Sequence:CCGGCCAGGACCAAGATGTCCTATTCTCGAGAATAGGACATCTTGGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016172.1-1007s1c1
Sequence:CCGGGCTGACGGAAATCTTCAAGAACTCGAGTTCTTGAAGATTTCCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016172.1-1385s1c1
Sequence:CCGGCCAGACACTAAATCGCACGTACTCGAGTACGTGCGATTTAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016172.1-543s1c1
Sequence:CCGGGCTCCAGATAAAGAGGCCATACTCGAGTATGGCCTCTTTATCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016172.2-741s21c1
Sequence:CCGGGAATTGTTTAAGAAGGCGAATCTCGAGATTCGCCTTCTTAAACAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016172.2-1037s21c1
Sequence:CCGGGCTGACGGAAATCTTCAAGAACTCGAGTTCTTGAAGATTTCCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016172.2-570s21c1
Sequence:CCGGGCTCCAGATAAAGAGGCCATACTCGAGTATGGCCTCTTTATCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016172.2-1415s21c1
Sequence:CCGGCCAGACACTAAATCGCACGTACTCGAGTACGTGCGATTTAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016172
VALIDATED
UBAC1 MISSION shRNA shRNA Plasmid DNA
UBA domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016172.1-440s1c1
Sequence:CCGGCCAGGACCAAGATGTCCTATTCTCGAGAATAGGACATCTTGGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016172.1-1007s1c1
Sequence:CCGGGCTGACGGAAATCTTCAAGAACTCGAGTTCTTGAAGATTTCCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016172.1-1385s1c1
Sequence:CCGGCCAGACACTAAATCGCACGTACTCGAGTACGTGCGATTTAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016172.1-543s1c1
Sequence:CCGGGCTCCAGATAAAGAGGCCATACTCGAGTATGGCCTCTTTATCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016172.2-741s21c1
Sequence:CCGGGAATTGTTTAAGAAGGCGAATCTCGAGATTCGCCTTCTTAAACAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016172.2-1037s21c1
Sequence:CCGGGCTGACGGAAATCTTCAAGAACTCGAGTTCTTGAAGATTTCCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016172.2-570s21c1
Sequence:CCGGGCTCCAGATAAAGAGGCCATACTCGAGTATGGCCTCTTTATCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016172.2-1415s21c1
Sequence:CCGGCCAGACACTAAATCGCACGTACTCGAGTACGTGCGATTTAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016172
VALIDATED
UBAC1 MISSION shRNA Lentiviral Transduction Particles
UBA domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016172.1-440s1c1
Sequence:CCGGCCAGGACCAAGATGTCCTATTCTCGAGAATAGGACATCTTGGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016172.1-1007s1c1
Sequence:CCGGGCTGACGGAAATCTTCAAGAACTCGAGTTCTTGAAGATTTCCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016172.1-1385s1c1
Sequence:CCGGCCAGACACTAAATCGCACGTACTCGAGTACGTGCGATTTAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016172.1-543s1c1
Sequence:CCGGGCTCCAGATAAAGAGGCCATACTCGAGTATGGCCTCTTTATCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016172.2-741s21c1
Sequence:CCGGGAATTGTTTAAGAAGGCGAATCTCGAGATTCGCCTTCTTAAACAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016172.2-1037s21c1
Sequence:CCGGGCTGACGGAAATCTTCAAGAACTCGAGTTCTTGAAGATTTCCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016172.2-570s21c1
Sequence:CCGGGCTCCAGATAAAGAGGCCATACTCGAGTATGGCCTCTTTATCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016172.2-1415s21c1
Sequence:CCGGCCAGACACTAAATCGCACGTACTCGAGTACGTGCGATTTAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133835
VALIDATED
UBAC1 MISSION shRNA Bacterial Glycerol Stock
UBA domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113260    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133835.1-1654s1c1
Sequence:CCGGGCTCCTGAAGTGCTACTTGAACTCGAGTTCAAGTAGCACTTCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133835.1-715s1c1
Sequence:CCGGGCAAATGCTATGCTGGATGAACTCGAGTTCATCCAGCATAGCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133835.1-880s1c1
Sequence:CCGGCCAGCTATTGACACACCTCTTCTCGAGAAGAGGTGTGTCAATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133835.1-529s1c1
Sequence:CCGGGCTCCAGACAAAGATGCTATTCTCGAGAATAGCATCTTTGTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133835.1-1276s1c1
Sequence:CCGGCCTAAGACATTGCTAGCATTTCTCGAGAAATGCTAGCAATGTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133835.1-880s21c1
Sequence:CCGGCCAGCTATTGACACACCTCTTCTCGAGAAGAGGTGTGTCAATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133835.1-715s21c1
Sequence:CCGGGCAAATGCTATGCTGGATGAACTCGAGTTCATCCAGCATAGCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133835.1-529s21c1
Sequence:CCGGGCTCCAGACAAAGATGCTATTCTCGAGAATAGCATCTTTGTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133835.1-1654s21c1
Sequence:CCGGGCTCCTGAAGTGCTACTTGAACTCGAGTTCAAGTAGCACTTCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133835.1-1276s21c1
Sequence:CCGGCCTAAGACATTGCTAGCATTTCTCGAGAAATGCTAGCAATGTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133835
VALIDATED
UBAC1 MISSION shRNA shRNA Plasmid DNA
UBA domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113260    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133835.1-1654s1c1
Sequence:CCGGGCTCCTGAAGTGCTACTTGAACTCGAGTTCAAGTAGCACTTCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133835.1-715s1c1
Sequence:CCGGGCAAATGCTATGCTGGATGAACTCGAGTTCATCCAGCATAGCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133835.1-880s1c1
Sequence:CCGGCCAGCTATTGACACACCTCTTCTCGAGAAGAGGTGTGTCAATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133835.1-529s1c1
Sequence:CCGGGCTCCAGACAAAGATGCTATTCTCGAGAATAGCATCTTTGTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133835.1-1276s1c1
Sequence:CCGGCCTAAGACATTGCTAGCATTTCTCGAGAAATGCTAGCAATGTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133835.1-880s21c1
Sequence:CCGGCCAGCTATTGACACACCTCTTCTCGAGAAGAGGTGTGTCAATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133835.1-715s21c1
Sequence:CCGGGCAAATGCTATGCTGGATGAACTCGAGTTCATCCAGCATAGCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133835.1-529s21c1
Sequence:CCGGGCTCCAGACAAAGATGCTATTCTCGAGAATAGCATCTTTGTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133835.1-1654s21c1
Sequence:CCGGGCTCCTGAAGTGCTACTTGAACTCGAGTTCAAGTAGCACTTCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133835.1-1276s21c1
Sequence:CCGGCCTAAGACATTGCTAGCATTTCTCGAGAAATGCTAGCAATGTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133835
VALIDATED
UBAC1 MISSION shRNA Lentiviral Transduction Particles
UBA domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113260    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133835.1-1654s1c1
Sequence:CCGGGCTCCTGAAGTGCTACTTGAACTCGAGTTCAAGTAGCACTTCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133835.1-715s1c1
Sequence:CCGGGCAAATGCTATGCTGGATGAACTCGAGTTCATCCAGCATAGCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133835.1-880s1c1
Sequence:CCGGCCAGCTATTGACACACCTCTTCTCGAGAAGAGGTGTGTCAATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133835.1-529s1c1
Sequence:CCGGGCTCCAGACAAAGATGCTATTCTCGAGAATAGCATCTTTGTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133835.1-1276s1c1
Sequence:CCGGCCTAAGACATTGCTAGCATTTCTCGAGAAATGCTAGCAATGTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133835.1-880s21c1
Sequence:CCGGCCAGCTATTGACACACCTCTTCTCGAGAAGAGGTGTGTCAATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133835.1-715s21c1
Sequence:CCGGGCAAATGCTATGCTGGATGAACTCGAGTTCATCCAGCATAGCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133835.1-529s21c1
Sequence:CCGGGCTCCAGACAAAGATGCTATTCTCGAGAATAGCATCTTTGTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133835.1-1654s21c1
Sequence:CCGGGCTCCTGAAGTGCTACTTGAACTCGAGTTCAAGTAGCACTTCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133835.1-1276s21c1
Sequence:CCGGCCTAAGACATTGCTAGCATTTCTCGAGAAATGCTAGCAATGTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks