EMAIL THIS PAGE TO A FRIEND

UBAC2

UBA domain containing 2

Synonyms: PHGDHL1
Gene ID:
Mouse(68889) ubiquitin associated domain containing 2
Rat(361094) UBA domain containing 2
chicken(418778) UBA domain containing 2
domestic cat(101080352) UBA domain containing 2
dog(608309) UBA domain containing 2
domestic guinea pig(100712776) UBA domain containing 2
naked mole-rat(101715507) UBA domain containing 2
cow(100125312) UBA domain containing 2
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026861 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026861 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026861 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_177967 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177967 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177967 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_177967 Rosetta Predictions human pricing
NM_001034937 Rosetta Predictions rat pricing
NM_026861 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164844 predicted 873
2 SASI_Hs02_00369440 predicted 1157
3 SASI_Hs01_00164845 predicted 841
4 SASI_Hs01_00164846 predicted 1509
5 SASI_Hs01_00164849 predicted 1201
6 SASI_Hs01_00164850 predicted 1419
7 SASI_Hs02_00369441 predicted 1396
8 SASI_Hs02_00369442 predicted 1374
9 SASI_Hs01_00164852 predicted 947
10 SASI_Hs01_00164853 predicted 635
11 SASI_Hs01_00164847 predicted 923
12 SASI_Hs01_00164848 predicted 875
13 SASI_Hs01_00164851 predicted 1053
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034937 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070986 predicted 629
2 SASI_Rn01_00070987 predicted 701
3 SASI_Rn01_00070988 predicted 661
4 SASI_Rn01_00070989 predicted 679
5 SASI_Rn01_00070990 predicted 638
6 SASI_Rn01_00070991 predicted 956
7 SASI_Rn01_00070992 predicted 738
8 SASI_Rn01_00070993 predicted 989
9 SASI_Rn01_00070994 predicted 996
10 SASI_Rn01_00070995 predicted 218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026861 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179595 predicted 503
2 SASI_Mm01_00179596 predicted 1273
3 SASI_Mm01_00179597 predicted 476
4 SASI_Mm01_00179598 predicted 1126
5 SASI_Mm01_00179599 predicted 691
6 SASI_Mm01_00179600 predicted 365
7 SASI_Mm01_00179601 predicted 542
8 SASI_Mm01_00179602 predicted 274
9 SASI_Mm01_00179603 predicted 338
10 SASI_Mm02_00331075 predicted 1140
11 SASI_Mm01_00179604 predicted 362
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026861
VALIDATED
UBAC2 MISSION shRNA Bacterial Glycerol Stock
UBA domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026861.2-681s21c1
Sequence:CCGGTGTAGCCATGAGTGGACTTATCTCGAGATAAGTCCACTCATGGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026861.2-352s21c1
Sequence:CCGGTGTAGTGGTCTTCTCATTTATCTCGAGATAAATGAGAAGACCACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026861.2-1306s21c1
Sequence:CCGGTTGCCGTGTAGTATCAAATAACTCGAGTTATTTGATACTACACGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026861.2-941s21c1
Sequence:CCGGAGCAGGGAGGAATGATCAATTCTCGAGAATTGATCATTCCTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026861.2-981s21c1
Sequence:CCGGTTTACGTCAGCGACGAAATATCTCGAGATATTTCGTCGCTGACGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026861
VALIDATED
UBAC2 MISSION shRNA shRNA Plasmid DNA
UBA domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026861.2-681s21c1
Sequence:CCGGTGTAGCCATGAGTGGACTTATCTCGAGATAAGTCCACTCATGGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026861.2-352s21c1
Sequence:CCGGTGTAGTGGTCTTCTCATTTATCTCGAGATAAATGAGAAGACCACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026861.2-1306s21c1
Sequence:CCGGTTGCCGTGTAGTATCAAATAACTCGAGTTATTTGATACTACACGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026861.2-941s21c1
Sequence:CCGGAGCAGGGAGGAATGATCAATTCTCGAGAATTGATCATTCCTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026861.2-981s21c1
Sequence:CCGGTTTACGTCAGCGACGAAATATCTCGAGATATTTCGTCGCTGACGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026861
VALIDATED
UBAC2 MISSION shRNA Lentiviral Transduction Particles
UBA domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026861.2-681s21c1
Sequence:CCGGTGTAGCCATGAGTGGACTTATCTCGAGATAAGTCCACTCATGGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026861.2-352s21c1
Sequence:CCGGTGTAGTGGTCTTCTCATTTATCTCGAGATAAATGAGAAGACCACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026861.2-1306s21c1
Sequence:CCGGTTGCCGTGTAGTATCAAATAACTCGAGTTATTTGATACTACACGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026861.2-941s21c1
Sequence:CCGGAGCAGGGAGGAATGATCAATTCTCGAGAATTGATCATTCCTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026861.2-981s21c1
Sequence:CCGGTTTACGTCAGCGACGAAATATCTCGAGATATTTCGTCGCTGACGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177967
VALIDATED
UBAC2 MISSION shRNA Bacterial Glycerol Stock
UBA domain containing 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_177967.2-802s21c1
Sequence:CCGGTTTGCTCTGTTTGTACCATTTCTCGAGAAATGGTACAAACAGAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_177967.2-1385s21c1
Sequence:GTACCGGCTTCAAACAATGACCTCAATGCTCGAGCATTGAGGTCATTGTTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_177967.2-2043s21c1
Sequence:CCGGCCATGAAACTTGGGTTAATTTCTCGAGAAATTAACCCAAGTTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_177967.2-1202s21c1
Sequence:CCGGAGCAGGGAGGAATGATCAATTCTCGAGAATTGATCATTCCTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_177967.2-933s21c1
Sequence:CCGGCATCTGGATTGTAGCCATAAGCTCGAGCTTATGGCTACAATCCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177967.2-1616s1c1
Sequence:CCGGGCCATTACATTAGCATGTATTCTCGAGAATACATGCTAATGTAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177967.2-564s1c1
Sequence:CCGGGCTTTCAAGTGGAGGGAAGTTCTCGAGAACTTCCCTCCACTTGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177967.2-1155s1c1
Sequence:CCGGGCAGCTGATGTTCTCTCAGTTCTCGAGAACTGAGAGAACATCAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177967.2-793s1c1
Sequence:CCGGGCACCTGTGTTTGCTCTGTTTCTCGAGAAACAGAGCAAACACAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177967.2-1384s1c1
Sequence:CCGGGCTTCAAACAATGACCTCAATCTCGAGATTGAGGTCATTGTTTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177967
VALIDATED
UBAC2 MISSION shRNA shRNA Plasmid DNA
UBA domain containing 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_177967.2-802s21c1
Sequence:CCGGTTTGCTCTGTTTGTACCATTTCTCGAGAAATGGTACAAACAGAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_177967.2-1385s21c1
Sequence:GTACCGGCTTCAAACAATGACCTCAATGCTCGAGCATTGAGGTCATTGTTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_177967.2-2043s21c1
Sequence:CCGGCCATGAAACTTGGGTTAATTTCTCGAGAAATTAACCCAAGTTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_177967.2-1202s21c1
Sequence:CCGGAGCAGGGAGGAATGATCAATTCTCGAGAATTGATCATTCCTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_177967.2-933s21c1
Sequence:CCGGCATCTGGATTGTAGCCATAAGCTCGAGCTTATGGCTACAATCCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177967.2-1616s1c1
Sequence:CCGGGCCATTACATTAGCATGTATTCTCGAGAATACATGCTAATGTAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177967.2-564s1c1
Sequence:CCGGGCTTTCAAGTGGAGGGAAGTTCTCGAGAACTTCCCTCCACTTGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177967.2-1155s1c1
Sequence:CCGGGCAGCTGATGTTCTCTCAGTTCTCGAGAACTGAGAGAACATCAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177967.2-793s1c1
Sequence:CCGGGCACCTGTGTTTGCTCTGTTTCTCGAGAAACAGAGCAAACACAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177967.2-1384s1c1
Sequence:CCGGGCTTCAAACAATGACCTCAATCTCGAGATTGAGGTCATTGTTTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177967
VALIDATED
UBAC2 MISSION shRNA Lentiviral Transduction Particles
UBA domain containing 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_177967.2-802s21c1
Sequence:CCGGTTTGCTCTGTTTGTACCATTTCTCGAGAAATGGTACAAACAGAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_177967.2-1385s21c1
Sequence:GTACCGGCTTCAAACAATGACCTCAATGCTCGAGCATTGAGGTCATTGTTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_177967.2-2043s21c1
Sequence:CCGGCCATGAAACTTGGGTTAATTTCTCGAGAAATTAACCCAAGTTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_177967.2-1202s21c1
Sequence:CCGGAGCAGGGAGGAATGATCAATTCTCGAGAATTGATCATTCCTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_177967.2-933s21c1
Sequence:CCGGCATCTGGATTGTAGCCATAAGCTCGAGCTTATGGCTACAATCCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177967.2-1616s1c1
Sequence:CCGGGCCATTACATTAGCATGTATTCTCGAGAATACATGCTAATGTAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177967.2-564s1c1
Sequence:CCGGGCTTTCAAGTGGAGGGAAGTTCTCGAGAACTTCCCTCCACTTGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177967.2-1155s1c1
Sequence:CCGGGCAGCTGATGTTCTCTCAGTTCTCGAGAACTGAGAGAACATCAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177967.2-793s1c1
Sequence:CCGGGCACCTGTGTTTGCTCTGTTTCTCGAGAAACAGAGCAAACACAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177967.2-1384s1c1
Sequence:CCGGGCTTCAAACAATGACCTCAATCTCGAGATTGAGGTCATTGTTTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks