EMAIL THIS PAGE TO A FRIEND

UBALD1

UBA-like domain containing 1

Synonyms: FAM100A
UniProtKB ID: Q8TB05, Q71MF6
Gene ID:
Mouse(207740) UBA-like domain containing 1
Rat(302941) UBA-like domain containing 1
cow(618672) UBA-like domain containing 1
naked mole-rat(101725997) UBA-like domain containing 1
domestic guinea pig(100720653) UBA-like domain containing 1
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145253 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145253 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145253 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145253 Rosetta Predictions human pricing
NM_001007668 Rosetta Predictions rat pricing
XM_622593 Rosetta Predictions mouse pricing
XM_974374 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145253 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160523 predicted 638
2 SASI_Hs01_00160524 predicted 802
3 SASI_Hs01_00160526 predicted 923
4 SASI_Hs01_00160527 predicted 789
5 SASI_Hs01_00160528 predicted 825
6 SASI_Hs01_00160529 predicted 344
7 SASI_Hs02_00365106 predicted 608
8 SASI_Hs01_00160530 predicted 809
9 SASI_Hs01_00160531 predicted 862
10 SASI_Hs01_00160532 predicted 375
11 SASI_Hs01_00160525 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007668 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095741 predicted 276
2 SASI_Rn02_00198796 predicted 899
3 SASI_Rn01_00095742 predicted 293
4 SASI_Rn01_00095743 predicted 777
5 SASI_Rn01_00095744 predicted 882
6 SASI_Rn01_00095745 predicted 993
7 SASI_Rn01_00095746 predicted 995
8 SASI_Rn01_00095747 predicted 916
9 SASI_Rn01_00095748 predicted 753
10 SASI_Rn01_00095749 predicted 559
11 SASI_Rn01_00095750 predicted 1006
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_622593 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00427918 predicted 817
2 SASI_Mm02_00427919 predicted 795
3 SASI_Mm02_00427920 predicted 1527
4 SASI_Mm02_00427921 predicted 648
5 SASI_Mm02_00427922 predicted 581
6 SASI_Mm02_00427923 predicted 1410
7 SASI_Mm02_00427924 predicted 1187
8 SASI_Mm02_00427925 predicted 1461
9 SASI_Mm02_00427926 predicted 1083
10 SASI_Mm02_00427927 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_974374 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242626 predicted 816
2 SASI_Mm01_00242627 predicted 795
3 SASI_Mm02_00445292 predicted 817
4 SASI_Mm02_00445293 predicted 739
5 SASI_Mm02_00445294 predicted 788
6 SASI_Mm02_00445295 predicted 912
7 SASI_Mm02_00445296 predicted 823
8 SASI_Mm02_00445297 predicted 801
9 SASI_Mm02_00445298 predicted 917
10 SASI_Mm02_00445299 predicted 876
11 SASI_Mm01_00242628 predicted 1531
12 SASI_Mm01_00242629 predicted 1539
13 SASI_Mm01_00242630 predicted 1424
14 SASI_Mm01_00242631 predicted 1490
15 SASI_Mm01_00242632 predicted 1190
16 SASI_Mm01_00242633 predicted 1469
17 SASI_Mm01_00242634 predicted 1090
18 SASI_Mm01_00242635 predicted 1419
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145253
VALIDATED
UBALD1 MISSION shRNA Bacterial Glycerol Stock
UBA-like domain containing 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180766    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145253.1-1064s1c1
Sequence:CCGGGCTCTTCAGAAGCAACCTAGTCTCGAGACTAGGTTGCTTCTGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145253.2-1150s21c1
Sequence:CCGGCAGCTGGACTTTGCATGTTAGCTCGAGCTAACATGCAAAGTCCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145253.2-169s21c1
Sequence:CCGGATCAACCAGTTCGTGCTGACGCTCGAGCGTCAGCACGAACTGGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145253.2-356s21c1
Sequence:CCGGCTGACGCTCTCACCATGTTCTCTCGAGAGAACATGGTGAGAGCGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145253.2-381s21c1
Sequence:CCGGTCTCAAGGCCTCCGAGAGCTTCTCGAGAAGCTCTCGGAGGCCTTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145253.2-645s21c1
Sequence:CCGGCATGGAGGCAGAGAGATAAGGCTCGAGCCTTATCTCTCTGCCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145253
VALIDATED
UBALD1 MISSION shRNA shRNA Plasmid DNA
UBA-like domain containing 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180766    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145253.1-1064s1c1
Sequence:CCGGGCTCTTCAGAAGCAACCTAGTCTCGAGACTAGGTTGCTTCTGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145253.2-1150s21c1
Sequence:CCGGCAGCTGGACTTTGCATGTTAGCTCGAGCTAACATGCAAAGTCCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145253.2-169s21c1
Sequence:CCGGATCAACCAGTTCGTGCTGACGCTCGAGCGTCAGCACGAACTGGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145253.2-356s21c1
Sequence:CCGGCTGACGCTCTCACCATGTTCTCTCGAGAGAACATGGTGAGAGCGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145253.2-381s21c1
Sequence:CCGGTCTCAAGGCCTCCGAGAGCTTCTCGAGAAGCTCTCGGAGGCCTTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145253.2-645s21c1
Sequence:CCGGCATGGAGGCAGAGAGATAAGGCTCGAGCCTTATCTCTCTGCCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145253
VALIDATED
UBALD1 MISSION shRNA Lentiviral Transduction Particles
UBA-like domain containing 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180766    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145253.1-1064s1c1
Sequence:CCGGGCTCTTCAGAAGCAACCTAGTCTCGAGACTAGGTTGCTTCTGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145253.2-1150s21c1
Sequence:CCGGCAGCTGGACTTTGCATGTTAGCTCGAGCTAACATGCAAAGTCCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145253.2-169s21c1
Sequence:CCGGATCAACCAGTTCGTGCTGACGCTCGAGCGTCAGCACGAACTGGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145253.2-356s21c1
Sequence:CCGGCTGACGCTCTCACCATGTTCTCTCGAGAGAACATGGTGAGAGCGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145253.2-381s21c1
Sequence:CCGGTCTCAAGGCCTCCGAGAGCTTCTCGAGAAGCTCTCGGAGGCCTTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145253.2-645s21c1
Sequence:CCGGCATGGAGGCAGAGAGATAAGGCTCGAGCCTTATCTCTCTGCCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks