EMAIL THIS PAGE TO A FRIEND

UBALD2

UBA-like domain containing 2

Synonyms: FAM100B
UniProtKB ID: Q8IYN6
Gene ID:
Mouse(319370) UBA-like domain containing 2
Rat(287840) UBA-like domain containing 2
Zebrafish(553806) UBA-like domain containing 2
domestic guinea pig(100723405) UBA-like domain containing 2
naked mole-rat(101710517) UBA-like domain containing 2
cow(618617) UBA-like domain containing 2
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176902 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176902 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176902 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182565 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182565 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182565 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182565 Rosetta Predictions human pricing
XM_001081720 Rosetta Predictions rat pricing
XM_213532 Rosetta Predictions rat pricing
NM_176902 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182565 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056339 predicted 1111
2 SASI_Hs01_00056340 predicted 1113
3 SASI_Hs01_00056341 predicted 1101
4 SASI_Hs01_00056342 predicted 610
5 SASI_Hs01_00056343 predicted 996
6 SASI_Hs01_00056344 predicted 947
7 SASI_Hs01_00056345 predicted 312
8 SASI_Hs01_00056346 predicted 959
9 SASI_Hs01_00056348 predicted 1330
10 SASI_Hs02_00370694 predicted 1219
11 SASI_Hs01_00056347 predicted 784
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081720 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00373155 predicted 526
2 SASI_Rn02_00373156 predicted 513
3 SASI_Rn02_00373157 predicted 452
4 SASI_Rn02_00373158 predicted 1232
5 SASI_Rn02_00373159 predicted 501
6 SASI_Rn02_00373160 predicted 759
7 SASI_Rn02_00373161 predicted 756
8 SASI_Rn02_00373162 predicted 456
9 SASI_Rn02_00373163 predicted 641
10 SASI_Rn02_00373164 predicted 1277
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213532 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374706 predicted 922
2 SASI_Rn02_00374707 predicted 908
3 SASI_Rn02_00374708 predicted 204
4 SASI_Rn02_00374709 predicted 1626
5 SASI_Rn02_00374710 predicted 900
6 SASI_Rn02_00374711 predicted 322
7 SASI_Rn02_00374712 predicted 240
8 SASI_Rn02_00374713 predicted 1673
9 SASI_Rn02_00374714 predicted 323
10 SASI_Rn02_00374715 predicted 1337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176902 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030737 predicted 426
2 SASI_Mm01_00030738 predicted 336
3 SASI_Mm01_00030740 predicted 440
4 SASI_Mm01_00030741 predicted 332
5 SASI_Mm01_00030742 predicted 359
6 SASI_Mm01_00030743 predicted 566
7 SASI_Mm01_00030744 predicted 335
8 SASI_Mm02_00346781 predicted 988
9 SASI_Mm02_00346782 predicted 867
10 SASI_Mm02_00346783 predicted 324
11 SASI_Mm01_00030739 predicted 469
12 SASI_Mm01_00030745 predicted 225
13 SASI_Mm01_00030746 predicted 219
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176902
VALIDATED
UBALD2 MISSION shRNA Bacterial Glycerol Stock
UBA-like domain containing 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176902.3-385s21c1
Sequence:CCGGACCACCCGCAGATGATGTGTACTCGAGTACACATCATCTGCGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176902.3-1196s21c1
Sequence:CCGGCCCATTGCTGGTAGACAATTTCTCGAGAAATTGTCTACCAGCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176902.3-346s21c1
Sequence:CCGGGCACGTTCTTTCAAGAAAGCACTCGAGTGCTTTCTTGAAAGAACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176902.3-454s21c1
Sequence:CCGGCCATGTTCTCCAAGCTTCGAACTCGAGTTCGAAGCTTGGAGAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176902.3-432s21c1
Sequence:CCGGCCCAACTTCCCTGATGCATTGCTCGAGCAATGCATCAGGGAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176902.2-228s1c1
Sequence:CCGGGCACGTTCTTTCAAGAAAGCACTCGAGTGCTTTCTTGAAAGAACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176902.2-221s1c1
Sequence:CCGGGCCCTAAGCACGTTCTTTCAACTCGAGTTGAAAGAACGTGCTTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176902.2-336s1c1
Sequence:CCGGCCATGTTCTCCAAGCTTCGAACTCGAGTTCGAAGCTTGGAGAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176902.2-223s1c1
Sequence:CCGGCCTAAGCACGTTCTTTCAAGACTCGAGTCTTGAAAGAACGTGCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176902
VALIDATED
UBALD2 MISSION shRNA shRNA Plasmid DNA
UBA-like domain containing 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176902.3-385s21c1
Sequence:CCGGACCACCCGCAGATGATGTGTACTCGAGTACACATCATCTGCGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176902.3-1196s21c1
Sequence:CCGGCCCATTGCTGGTAGACAATTTCTCGAGAAATTGTCTACCAGCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176902.3-346s21c1
Sequence:CCGGGCACGTTCTTTCAAGAAAGCACTCGAGTGCTTTCTTGAAAGAACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176902.3-454s21c1
Sequence:CCGGCCATGTTCTCCAAGCTTCGAACTCGAGTTCGAAGCTTGGAGAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176902.3-432s21c1
Sequence:CCGGCCCAACTTCCCTGATGCATTGCTCGAGCAATGCATCAGGGAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176902.2-228s1c1
Sequence:CCGGGCACGTTCTTTCAAGAAAGCACTCGAGTGCTTTCTTGAAAGAACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176902.2-221s1c1
Sequence:CCGGGCCCTAAGCACGTTCTTTCAACTCGAGTTGAAAGAACGTGCTTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176902.2-336s1c1
Sequence:CCGGCCATGTTCTCCAAGCTTCGAACTCGAGTTCGAAGCTTGGAGAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176902.2-223s1c1
Sequence:CCGGCCTAAGCACGTTCTTTCAAGACTCGAGTCTTGAAAGAACGTGCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176902
VALIDATED
UBALD2 MISSION shRNA Lentiviral Transduction Particles
UBA-like domain containing 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176902.3-385s21c1
Sequence:CCGGACCACCCGCAGATGATGTGTACTCGAGTACACATCATCTGCGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176902.3-1196s21c1
Sequence:CCGGCCCATTGCTGGTAGACAATTTCTCGAGAAATTGTCTACCAGCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176902.3-346s21c1
Sequence:CCGGGCACGTTCTTTCAAGAAAGCACTCGAGTGCTTTCTTGAAAGAACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176902.3-454s21c1
Sequence:CCGGCCATGTTCTCCAAGCTTCGAACTCGAGTTCGAAGCTTGGAGAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176902.3-432s21c1
Sequence:CCGGCCCAACTTCCCTGATGCATTGCTCGAGCAATGCATCAGGGAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176902.2-228s1c1
Sequence:CCGGGCACGTTCTTTCAAGAAAGCACTCGAGTGCTTTCTTGAAAGAACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176902.2-221s1c1
Sequence:CCGGGCCCTAAGCACGTTCTTTCAACTCGAGTTGAAAGAACGTGCTTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176902.2-336s1c1
Sequence:CCGGCCATGTTCTCCAAGCTTCGAACTCGAGTTCGAAGCTTGGAGAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176902.2-223s1c1
Sequence:CCGGCCTAAGCACGTTCTTTCAAGACTCGAGTCTTGAAAGAACGTGCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182565
VALIDATED
UBALD2 MISSION shRNA Bacterial Glycerol Stock
UBA-like domain containing 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182565.2-954s1c1
Sequence:CCGGCAGAGCTGATGGAGTGATGTTCTCGAGAACATCACTCCATCAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_182565.2-280s1c1
Sequence:CCGGCCAAGAAACCAACATTCCCAACTCGAGTTGGGAATGTTGGTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182565.2-169s1c1
Sequence:CCGGCCAGGTCATGATCAACCAGTTCTCGAGAACTGGTTGATCATGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182565.2-266s1c1
Sequence:CCGGCTGAGCACGTTCTTCCAAGAACTCGAGTTCTTGGAAGAACGTGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182565.2-1014s1c1
Sequence:CCGGCATGCCTTCTGGAATCTGGAACTCGAGTTCCAGATTCCAGAAGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182565.2-175s1c1
Sequence:CCGGCATGATCAACCAGTTCGTGCTCTCGAGAGCACGAACTGGTTGATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182565.2-738s1c1
Sequence:CCGGCGAAGATCGCACTGGAAGATTCTCGAGAATCTTCCAGTGCGATCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139632    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182565.2-1001s1c1
Sequence:CCGGCTCCTTTAACAGCCATGCCTTCTCGAGAAGGCATGGCTGTTAAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182565.2-270s1c1
Sequence:CCGGGCACGTTCTTCCAAGAAACCACTCGAGTGGTTTCTTGGAAGAACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182565.2-273s1c1
Sequence:CCGGCGTTCTTCCAAGAAACCAACACTCGAGTGTTGGTTTCTTGGAAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182565.2-281s1c1
Sequence:CCGGCAAGAAACCAACATTCCCAACCTCGAGGTTGGGAATGTTGGTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182565
VALIDATED
UBALD2 MISSION shRNA shRNA Plasmid DNA
UBA-like domain containing 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182565.2-954s1c1
Sequence:CCGGCAGAGCTGATGGAGTGATGTTCTCGAGAACATCACTCCATCAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_182565.2-280s1c1
Sequence:CCGGCCAAGAAACCAACATTCCCAACTCGAGTTGGGAATGTTGGTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182565.2-169s1c1
Sequence:CCGGCCAGGTCATGATCAACCAGTTCTCGAGAACTGGTTGATCATGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182565.2-266s1c1
Sequence:CCGGCTGAGCACGTTCTTCCAAGAACTCGAGTTCTTGGAAGAACGTGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182565.2-1014s1c1
Sequence:CCGGCATGCCTTCTGGAATCTGGAACTCGAGTTCCAGATTCCAGAAGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182565.2-175s1c1
Sequence:CCGGCATGATCAACCAGTTCGTGCTCTCGAGAGCACGAACTGGTTGATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182565.2-738s1c1
Sequence:CCGGCGAAGATCGCACTGGAAGATTCTCGAGAATCTTCCAGTGCGATCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139632    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182565.2-1001s1c1
Sequence:CCGGCTCCTTTAACAGCCATGCCTTCTCGAGAAGGCATGGCTGTTAAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182565.2-270s1c1
Sequence:CCGGGCACGTTCTTCCAAGAAACCACTCGAGTGGTTTCTTGGAAGAACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182565.2-273s1c1
Sequence:CCGGCGTTCTTCCAAGAAACCAACACTCGAGTGTTGGTTTCTTGGAAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182565.2-281s1c1
Sequence:CCGGCAAGAAACCAACATTCCCAACCTCGAGGTTGGGAATGTTGGTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182565
VALIDATED
UBALD2 MISSION shRNA Lentiviral Transduction Particles
UBA-like domain containing 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182565.2-954s1c1
Sequence:CCGGCAGAGCTGATGGAGTGATGTTCTCGAGAACATCACTCCATCAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_182565.2-280s1c1
Sequence:CCGGCCAAGAAACCAACATTCCCAACTCGAGTTGGGAATGTTGGTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182565.2-169s1c1
Sequence:CCGGCCAGGTCATGATCAACCAGTTCTCGAGAACTGGTTGATCATGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182565.2-266s1c1
Sequence:CCGGCTGAGCACGTTCTTCCAAGAACTCGAGTTCTTGGAAGAACGTGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182565.2-1014s1c1
Sequence:CCGGCATGCCTTCTGGAATCTGGAACTCGAGTTCCAGATTCCAGAAGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182565.2-175s1c1
Sequence:CCGGCATGATCAACCAGTTCGTGCTCTCGAGAGCACGAACTGGTTGATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_182565.2-738s1c1
Sequence:CCGGCGAAGATCGCACTGGAAGATTCTCGAGAATCTTCCAGTGCGATCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139632    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182565.2-1001s1c1
Sequence:CCGGCTCCTTTAACAGCCATGCCTTCTCGAGAAGGCATGGCTGTTAAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182565.2-270s1c1
Sequence:CCGGGCACGTTCTTCCAAGAAACCACTCGAGTGGTTTCTTGGAAGAACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182565.2-273s1c1
Sequence:CCGGCGTTCTTCCAAGAAACCAACACTCGAGTGTTGGTTTCTTGGAAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182565.2-281s1c1
Sequence:CCGGCAAGAAACCAACATTCCCAACCTCGAGGTTGGGAATGTTGGTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks