EMAIL THIS PAGE TO A FRIEND

UBAP1

ubiquitin associated protein 1

Synonyms: NAG20 UAP UBAP UBAP-1
Gene ID:
Human(51271) Summary: This gene is a member of the UBA domain family, whose members include proteins having connections to ubiquitin and the ubiquitination pathway. The ubiquitin associated domain is thought to be a non-covalent ubiquitin binding domain consisting of a compact three helix bundle. This particular protein originates from a gene locus in a refined region on chromosome 9 undergoing loss of heterozygosity in nasopharyngeal carcinoma (NPC). Taking into account its cytogenetic location, this UBA domain family member is being studies as a putative target for mutation in nasopharyngeal carcinomas. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
Mouse(67123) ubiquitin-associated protein 1
Rat(362502) ubiquitin-associated protein 1
cow(517788) ubiquitin associated protein 1
sheep(101101952) ubiquitin associated protein 1
naked mole-rat(101698547) ubiquitin associated protein 1
domestic guinea pig(100720975) ubiquitin associated protein 1
Zebrafish(393183) ubiquitin associated protein 1
domestic cat(101081837) ubiquitin associated protein 1
Horse(100053997) ubiquitin associated protein 1
dog(474745) ubiquitin associated protein 1
chicken(431652) ubiquitin associated protein 1
156 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016525 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016525 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016525 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023305 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023305 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023305 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016525 Rosetta Predictions human pricing
NM_001012190 Rosetta Predictions rat pricing
XM_575802 Rosetta Predictions rat pricing
NM_023305 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126614 predicted 801
2 SASI_Hs02_00349625 predicted 240
3 SASI_Hs01_00126615 predicted 1278
4 SASI_Hs01_00126616 predicted 1282
5 SASI_Hs02_00349626 predicted 1476
6 SASI_Hs01_00126619 predicted 1000
7 SASI_Hs01_00126620 predicted 1132
8 SASI_Hs01_00126621 predicted 1283
9 SASI_Hs01_00126622 predicted 1429
10 SASI_Hs01_00126623 predicted 796
11 SASI_Hs01_00126617 predicted 679
12 SASI_Hs01_00126618 predicted 712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012190 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121435 predicted 461
2 SASI_Rn01_00121436 predicted 339
3 SASI_Rn01_00121437 predicted 700
4 SASI_Rn02_00200408 predicted 340
5 SASI_Rn01_00121439 predicted 1389
6 SASI_Rn01_00121440 predicted 383
7 SASI_Rn01_00121441 predicted 1391
8 SASI_Rn01_00121442 predicted 357
9 SASI_Rn01_00121443 predicted 812
10 SASI_Rn01_00121444 predicted 1102
11 SASI_Rn01_00121438 predicted 1614
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575802 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00182393 predicted 582
2 SASI_Rn01_00182394 predicted 783
3 SASI_Rn01_00182395 predicted 657
4 SASI_Rn01_00182396 predicted 1038
5 SASI_Rn01_00182397 predicted 912
6 SASI_Rn01_00182398 predicted 539
7 SASI_Rn01_00182399 predicted 543
8 SASI_Rn01_00182400 predicted 935
9 SASI_Rn01_00182401 predicted 702
10 SASI_Rn01_00182402 predicted 993
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023305 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200820 predicted 453
2 SASI_Mm01_00200821 predicted 714
3 SASI_Mm01_00200822 predicted 678
4 SASI_Mm01_00200823 predicted 372
5 SASI_Mm01_00200824 predicted 1513
6 SASI_Mm01_00200825 predicted 1413
7 SASI_Mm01_00200826 predicted 1640
8 SASI_Mm01_00200827 predicted 396
9 SASI_Mm01_00200828 predicted 905
10 SASI_Mm01_00200829 predicted 500
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016525
UBAP1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin associated protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016525.x-1685s1c1
Sequence:CCGGCACAACAATGACCAGGACAATCTCGAGATTGTCCTGGTCATTGTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016525.x-327s1c1
Sequence:CCGGCAGCTAAAGTTGGTCTACCTACTCGAGTAGGTAGACCAACTTTAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016525.x-1086s1c1
Sequence:CCGGCGAGCACTTTCCATAGCACATCTCGAGATGTGCTATGGAAAGTGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004186    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016525.x-2226s1c1
Sequence:CCGGCCCTCCTAACAAAGTCTCATACTCGAGTATGAGACTTTGTTAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016525.x-1505s1c1
Sequence:CCGGCTCGACTATCTCTTTGCACATCTCGAGATGTGCAAAGAGATAGTCGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016525.3-569s21c1
Sequence:CCGGACAATGCCACCTCCTATTAACCTCGAGGTTAATAGGAGGTGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016525.3-2226s21c1
Sequence:CCGGCCCTCCTAACAAAGTCTCATACTCGAGTATGAGACTTTGTTAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016525.3-1685s21c1
Sequence:CCGGCACAACAATGACCAGGACAATCTCGAGATTGTCCTGGTCATTGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016525.3-1086s21c1
Sequence:CCGGCGAGCACTTTCCATAGCACATCTCGAGATGTGCTATGGAAAGTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016525
UBAP1 MISSION shRNA shRNA Plasmid DNA
ubiquitin associated protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016525.x-1685s1c1
Sequence:CCGGCACAACAATGACCAGGACAATCTCGAGATTGTCCTGGTCATTGTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016525.x-327s1c1
Sequence:CCGGCAGCTAAAGTTGGTCTACCTACTCGAGTAGGTAGACCAACTTTAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016525.x-1086s1c1
Sequence:CCGGCGAGCACTTTCCATAGCACATCTCGAGATGTGCTATGGAAAGTGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004186    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016525.x-2226s1c1
Sequence:CCGGCCCTCCTAACAAAGTCTCATACTCGAGTATGAGACTTTGTTAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016525.x-1505s1c1
Sequence:CCGGCTCGACTATCTCTTTGCACATCTCGAGATGTGCAAAGAGATAGTCGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016525.3-569s21c1
Sequence:CCGGACAATGCCACCTCCTATTAACCTCGAGGTTAATAGGAGGTGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016525.3-2226s21c1
Sequence:CCGGCCCTCCTAACAAAGTCTCATACTCGAGTATGAGACTTTGTTAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016525.3-1685s21c1
Sequence:CCGGCACAACAATGACCAGGACAATCTCGAGATTGTCCTGGTCATTGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016525.3-1086s21c1
Sequence:CCGGCGAGCACTTTCCATAGCACATCTCGAGATGTGCTATGGAAAGTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016525
UBAP1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin associated protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016525.x-1685s1c1
Sequence:CCGGCACAACAATGACCAGGACAATCTCGAGATTGTCCTGGTCATTGTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016525.x-327s1c1
Sequence:CCGGCAGCTAAAGTTGGTCTACCTACTCGAGTAGGTAGACCAACTTTAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016525.x-1086s1c1
Sequence:CCGGCGAGCACTTTCCATAGCACATCTCGAGATGTGCTATGGAAAGTGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004186    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016525.x-2226s1c1
Sequence:CCGGCCCTCCTAACAAAGTCTCATACTCGAGTATGAGACTTTGTTAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016525.x-1505s1c1
Sequence:CCGGCTCGACTATCTCTTTGCACATCTCGAGATGTGCAAAGAGATAGTCGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016525.3-569s21c1
Sequence:CCGGACAATGCCACCTCCTATTAACCTCGAGGTTAATAGGAGGTGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016525.3-2226s21c1
Sequence:CCGGCCCTCCTAACAAAGTCTCATACTCGAGTATGAGACTTTGTTAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016525.3-1685s21c1
Sequence:CCGGCACAACAATGACCAGGACAATCTCGAGATTGTCCTGGTCATTGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016525.3-1086s21c1
Sequence:CCGGCGAGCACTTTCCATAGCACATCTCGAGATGTGCTATGGAAAGTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023305
VALIDATED
UBAP1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin associated protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023305.2-2471s1c1
Sequence:CCGGCCCTGCTTTAGGATGACACAACTCGAGTTGTGTCATCCTAAAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023305.2-694s1c1
Sequence:CCGGCCCATTTGATAATCTGGAGTTCTCGAGAACTCCAGATTATCAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023305.2-695s1c1
Sequence:CCGGCCATTTGATAATCTGGAGTTACTCGAGTAACTCCAGATTATCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023305.2-1379s1c1
Sequence:CCGGCGGCAATGTGTAGAGACAGTACTCGAGTACTGTCTCTACACATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023305.2-859s1c1
Sequence:CCGGGCAGGCAACCTTAGACTTCAACTCGAGTTGAAGTCTAAGGTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023305.3-798s21c1
Sequence:CCGGAGGAACCACTGGACCCATAATCTCGAGATTATGGGTCCAGTGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023305.3-431s21c1
Sequence:CCGGTTGAGTGGGCTGAAGATATTACTCGAGTAATATCTTCAGCCCACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340302    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023305.3-1927s21c1
Sequence:CCGGTAGGAAGATTTGGGCATATATCTCGAGATATATGCCCAAATCTTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023305.3-291s21c1
Sequence:CCGGCCTTGACGATGTCCCATTTAACTCGAGTTAAATGGGACATCGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023305.3-577s21c1
Sequence:CCGGACAATGCCACCTCCTATTAACCTCGAGGTTAATAGGAGGTGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023305
VALIDATED
UBAP1 MISSION shRNA shRNA Plasmid DNA
ubiquitin associated protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023305.2-2471s1c1
Sequence:CCGGCCCTGCTTTAGGATGACACAACTCGAGTTGTGTCATCCTAAAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023305.2-694s1c1
Sequence:CCGGCCCATTTGATAATCTGGAGTTCTCGAGAACTCCAGATTATCAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023305.2-695s1c1
Sequence:CCGGCCATTTGATAATCTGGAGTTACTCGAGTAACTCCAGATTATCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023305.2-1379s1c1
Sequence:CCGGCGGCAATGTGTAGAGACAGTACTCGAGTACTGTCTCTACACATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023305.2-859s1c1
Sequence:CCGGGCAGGCAACCTTAGACTTCAACTCGAGTTGAAGTCTAAGGTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023305.3-798s21c1
Sequence:CCGGAGGAACCACTGGACCCATAATCTCGAGATTATGGGTCCAGTGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023305.3-431s21c1
Sequence:CCGGTTGAGTGGGCTGAAGATATTACTCGAGTAATATCTTCAGCCCACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340302    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023305.3-1927s21c1
Sequence:CCGGTAGGAAGATTTGGGCATATATCTCGAGATATATGCCCAAATCTTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023305.3-291s21c1
Sequence:CCGGCCTTGACGATGTCCCATTTAACTCGAGTTAAATGGGACATCGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023305.3-577s21c1
Sequence:CCGGACAATGCCACCTCCTATTAACCTCGAGGTTAATAGGAGGTGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023305
VALIDATED
UBAP1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin associated protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023305.2-2471s1c1
Sequence:CCGGCCCTGCTTTAGGATGACACAACTCGAGTTGTGTCATCCTAAAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023305.2-694s1c1
Sequence:CCGGCCCATTTGATAATCTGGAGTTCTCGAGAACTCCAGATTATCAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023305.2-695s1c1
Sequence:CCGGCCATTTGATAATCTGGAGTTACTCGAGTAACTCCAGATTATCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023305.2-1379s1c1
Sequence:CCGGCGGCAATGTGTAGAGACAGTACTCGAGTACTGTCTCTACACATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023305.2-859s1c1
Sequence:CCGGGCAGGCAACCTTAGACTTCAACTCGAGTTGAAGTCTAAGGTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023305.3-798s21c1
Sequence:CCGGAGGAACCACTGGACCCATAATCTCGAGATTATGGGTCCAGTGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023305.3-431s21c1
Sequence:CCGGTTGAGTGGGCTGAAGATATTACTCGAGTAATATCTTCAGCCCACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340302    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023305.3-1927s21c1
Sequence:CCGGTAGGAAGATTTGGGCATATATCTCGAGATATATGCCCAAATCTTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023305.3-291s21c1
Sequence:CCGGCCTTGACGATGTCCCATTTAACTCGAGTTAAATGGGACATCGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023305.3-577s21c1
Sequence:CCGGACAATGCCACCTCCTATTAACCTCGAGGTTAATAGGAGGTGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks