EMAIL THIS PAGE TO A FRIEND

UBAP1L

ubiquitin associated protein 1-like

Synonyms: UBAP-1L
UniProtKB ID: F5GYI3
Gene ID:
Rat(691572) ubiquitin associated protein 1-like
chicken(769261) ubiquitin associated protein 1-like
domestic cat(101096482) ubiquitin associated protein 1-like
naked mole-rat(101725074) ubiquitin associated protein 1-like
cow(783141) ubiquitin associated protein 1-like
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001163692 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001163692 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001163692 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001718742 Rosetta Predictions human pricing
XM_372574 Rosetta Predictions human pricing
XM_940509 Rosetta Predictions human pricing
XM_001078882 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718742 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00426002 predicted 223
2 SASI_Hs02_00426003 predicted 1156
3 SASI_Hs02_00426004 predicted 220
4 SASI_Hs02_00426005 predicted 1151
5 SASI_Hs02_00426006 predicted 1078
6 SASI_Hs02_00426007 predicted 228
7 SASI_Hs02_00426008 predicted 1075
8 SASI_Hs02_00426009 predicted 556
9 SASI_Hs02_00426010 predicted 319
10 SASI_Hs02_00426011 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372574 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00294469 predicted 227
2 SASI_Hs01_00294470 predicted 1150
3 SASI_Hs01_00294471 predicted 220
4 SASI_Hs01_00294472 predicted 1153
5 SASI_Hs01_00294473 predicted 1077
6 SASI_Hs01_00294474 predicted 225
7 SASI_Hs01_00294475 predicted 1065
8 SASI_Hs01_00294476 predicted 554
9 SASI_Hs01_00294477 predicted 312
10 SASI_Hs01_00294478 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_940509 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00484264 predicted 223
2 SASI_Hs02_00484265 predicted 1158
3 SASI_Hs02_00484266 predicted 219
4 SASI_Hs02_00484267 predicted 1152
5 SASI_Hs02_00484268 predicted 1084
6 SASI_Hs02_00484269 predicted 230
7 SASI_Hs02_00484270 predicted 1067
8 SASI_Hs02_00484271 predicted 550
9 SASI_Hs02_00484272 predicted 317
10 SASI_Hs02_00484273 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078882 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00362340 predicted 911
2 SASI_Rn02_00362341 predicted 847
3 SASI_Rn02_00362342 predicted 823
4 SASI_Rn02_00362343 predicted 834
5 SASI_Rn02_00362344 predicted 859
6 SASI_Rn02_00362345 predicted 853
7 SASI_Rn02_00362346 predicted 825
8 SASI_Rn02_00362347 predicted 878
9 SASI_Rn02_00362348 predicted 861
10 SASI_Rn02_00362349 predicted 913
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163692
UBAP1L MISSION shRNA Bacterial Glycerol Stock
ubiquitin associated protein 1-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163692.1-1083s21c1
Sequence:CCGGCCTGTTACGTCAGGGATATGACTCGAGTCATATCCCTGACGTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163692.1-953s21c1
Sequence:CCGGAGGAGGAGCAAGACCTCATTGCTCGAGCAATGAGGTCTTGCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163692.1-244s21c1
Sequence:CCGGGAAGTTCTGCTGGGTTCTATGCTCGAGCATAGAACCCAGCAGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163692.1-902s21c1
Sequence:CCGGCCCACAAGTCACACCCTGATACTCGAGTATCAGGGTGTGACTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163692.1-1116s21c1
Sequence:CCGGGGATGAGGCCATGGAGATGTTCTCGAGAACATCTCCATGGCCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163692
UBAP1L MISSION shRNA shRNA Plasmid DNA
ubiquitin associated protein 1-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163692.1-1083s21c1
Sequence:CCGGCCTGTTACGTCAGGGATATGACTCGAGTCATATCCCTGACGTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163692.1-953s21c1
Sequence:CCGGAGGAGGAGCAAGACCTCATTGCTCGAGCAATGAGGTCTTGCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163692.1-244s21c1
Sequence:CCGGGAAGTTCTGCTGGGTTCTATGCTCGAGCATAGAACCCAGCAGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163692.1-902s21c1
Sequence:CCGGCCCACAAGTCACACCCTGATACTCGAGTATCAGGGTGTGACTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163692.1-1116s21c1
Sequence:CCGGGGATGAGGCCATGGAGATGTTCTCGAGAACATCTCCATGGCCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163692
UBAP1L MISSION shRNA Lentiviral Transduction Particles
ubiquitin associated protein 1-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163692.1-1083s21c1
Sequence:CCGGCCTGTTACGTCAGGGATATGACTCGAGTCATATCCCTGACGTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163692.1-953s21c1
Sequence:CCGGAGGAGGAGCAAGACCTCATTGCTCGAGCAATGAGGTCTTGCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163692.1-244s21c1
Sequence:CCGGGAAGTTCTGCTGGGTTCTATGCTCGAGCATAGAACCCAGCAGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163692.1-902s21c1
Sequence:CCGGCCCACAAGTCACACCCTGATACTCGAGTATCAGGGTGTGACTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163692.1-1116s21c1
Sequence:CCGGGGATGAGGCCATGGAGATGTTCTCGAGAACATCTCCATGGCCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks