EMAIL THIS PAGE TO A FRIEND

UBAP2

ubiquitin associated protein 2

Synonyms: UBAP-2
UniProtKB ID: Q5T6F2, Q2M2R4, Q6PK34, Q8NC94, Q9P237
Gene ID:
Human(55833) Summary: This gene is a novel gene isolated based on its expression in the human adrenal gland. The full-length protein encoded by this gene contains a UBA-domain (ubiquitin associated domain), which is a motif found in several proteins having connections to ubiquitin and the ubiquitination pathway. In addition, the protein contains a region similar to a domain found in members of the atrophin-1 family. The function of this protein has not been determined. Additional alternate splice variants may exist, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(68926) ubiquitin-associated protein 2
Rat(313169) ubiquitin-associated protein 2
cow(506577) ubiquitin associated protein 2
sheep(101102619) ubiquitin associated protein 2
naked mole-rat(101711472) ubiquitin associated protein 2
domestic guinea pig(100724381) ubiquitin associated protein 2
Zebrafish(563733) ubiquitin associated protein 2
Horse(100053948) ubiquitin associated protein 2
domestic cat(101081174) ubiquitin associated protein 2
dog(481583) ubiquitin associated protein 2
chicken(407091) ubiquitin associated protein 2
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018449 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018449 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018449 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026872 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026872 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026872 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018449 Rosetta Predictions human pricing
NM_001107928 Rosetta Predictions rat pricing
NM_026872 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018449 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351989 predicted 1805
2 SASI_Hs01_00159913 predicted 2029
3 SASI_Hs01_00159914 predicted 809
4 SASI_Hs01_00159915 predicted 3518
5 SASI_Hs01_00159916 predicted 703
6 SASI_Hs01_00159917 predicted 1788
7 SASI_Hs01_00159918 predicted 3453
8 SASI_Hs01_00159919 predicted 1674
9 SASI_Hs02_00351990 predicted 2070
10 SASI_Hs01_00159921 predicted 2570
11 SASI_Hs01_00159912 predicted 1458
12 SASI_Hs01_00159920 predicted 1953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107928 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233665 predicted 2721
2 SASI_Rn02_00233666 predicted 1834
3 SASI_Rn02_00233667 predicted 1822
4 SASI_Rn02_00233668 predicted 713
5 SASI_Rn02_00233669 predicted 1966
6 SASI_Rn02_00233670 predicted 1975
7 SASI_Rn02_00233671 predicted 3612
8 SASI_Rn02_00233672 predicted 2315
9 SASI_Rn02_00233673 predicted 1403
10 SASI_Rn02_00233674 predicted 2628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026872 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142438 predicted 1223
2 SASI_Mm01_00142439 predicted 1814
3 SASI_Mm01_00142440 predicted 2731
4 SASI_Mm01_00142441 predicted 1824
5 SASI_Mm01_00142443 predicted 3179
6 SASI_Mm02_00331112 predicted 1885
7 SASI_Mm01_00142444 predicted 1980
8 SASI_Mm02_00331113 predicted 3124
9 SASI_Mm01_00142445 predicted 1958
10 SASI_Mm01_00142446 predicted 2634
11 SASI_Mm01_00142442 predicted 932
12 SASI_Mm01_00142447 predicted 3146
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018449
VALIDATED
UBAP2 MISSION shRNA Bacterial Glycerol Stock
ubiquitin associated protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018449.2-355s21c1
Sequence:CCGGATGTGAACAAAGCTATCAATACTCGAGTATTGATAGCTTTGTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018449.2-2673s21c1
Sequence:CCGGGATGGGAGCCTAGCTAATAATCTCGAGATTATTAGCTAGGCTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018449.2-1691s21c1
Sequence:CCGGAGCAGATGTCACAGGATTAAACTCGAGTTTAATCCTGTGACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018449.2-3522s21c1
Sequence:CCGGAGAACACACGAGCACGTATTTCTCGAGAAATACGTGCTCGTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018449.2-2995s21c1
Sequence:CCGGACGGCTACAGTACAGGTTATGCTCGAGCATAACCTGTACTGTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018449.x-507s1c1
Sequence:CCGGCGTGGAAACAACAACCGGAAACTCGAGTTTCCGGTTGTTGTTTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018449.x-4259s1c1
Sequence:CCGGCCACCTAATAAAGTTCTGAGACTCGAGTCTCAGAACTTTATTAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018449.x-1605s1c1
Sequence:CCGGCCACAGCCCAAACACATCAAACTCGAGTTTGATGTGTTTGGGCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018449.x-798s1c1
Sequence:CCGGGCATCAAATACTCACAACATACTCGAGTATGTTGTGAGTATTTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018449.x-2069s1c1
Sequence:CCGGGCAGACACTAGACACTCCAAACTCGAGTTTGGAGTGTCTAGTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018449
VALIDATED
UBAP2 MISSION shRNA shRNA Plasmid DNA
ubiquitin associated protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018449.2-355s21c1
Sequence:CCGGATGTGAACAAAGCTATCAATACTCGAGTATTGATAGCTTTGTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018449.2-2673s21c1
Sequence:CCGGGATGGGAGCCTAGCTAATAATCTCGAGATTATTAGCTAGGCTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018449.2-1691s21c1
Sequence:CCGGAGCAGATGTCACAGGATTAAACTCGAGTTTAATCCTGTGACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018449.2-3522s21c1
Sequence:CCGGAGAACACACGAGCACGTATTTCTCGAGAAATACGTGCTCGTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018449.2-2995s21c1
Sequence:CCGGACGGCTACAGTACAGGTTATGCTCGAGCATAACCTGTACTGTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018449.x-507s1c1
Sequence:CCGGCGTGGAAACAACAACCGGAAACTCGAGTTTCCGGTTGTTGTTTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018449.x-4259s1c1
Sequence:CCGGCCACCTAATAAAGTTCTGAGACTCGAGTCTCAGAACTTTATTAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018449.x-1605s1c1
Sequence:CCGGCCACAGCCCAAACACATCAAACTCGAGTTTGATGTGTTTGGGCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018449.x-798s1c1
Sequence:CCGGGCATCAAATACTCACAACATACTCGAGTATGTTGTGAGTATTTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018449.x-2069s1c1
Sequence:CCGGGCAGACACTAGACACTCCAAACTCGAGTTTGGAGTGTCTAGTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018449
VALIDATED
UBAP2 MISSION shRNA Lentiviral Transduction Particles
ubiquitin associated protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018449.2-355s21c1
Sequence:CCGGATGTGAACAAAGCTATCAATACTCGAGTATTGATAGCTTTGTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018449.2-2673s21c1
Sequence:CCGGGATGGGAGCCTAGCTAATAATCTCGAGATTATTAGCTAGGCTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018449.2-1691s21c1
Sequence:CCGGAGCAGATGTCACAGGATTAAACTCGAGTTTAATCCTGTGACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018449.2-3522s21c1
Sequence:CCGGAGAACACACGAGCACGTATTTCTCGAGAAATACGTGCTCGTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018449.2-2995s21c1
Sequence:CCGGACGGCTACAGTACAGGTTATGCTCGAGCATAACCTGTACTGTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018449.x-507s1c1
Sequence:CCGGCGTGGAAACAACAACCGGAAACTCGAGTTTCCGGTTGTTGTTTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018449.x-4259s1c1
Sequence:CCGGCCACCTAATAAAGTTCTGAGACTCGAGTCTCAGAACTTTATTAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018449.x-1605s1c1
Sequence:CCGGCCACAGCCCAAACACATCAAACTCGAGTTTGATGTGTTTGGGCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018449.x-798s1c1
Sequence:CCGGGCATCAAATACTCACAACATACTCGAGTATGTTGTGAGTATTTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018449.x-2069s1c1
Sequence:CCGGGCAGACACTAGACACTCCAAACTCGAGTTTGGAGTGTCTAGTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026872
VALIDATED
UBAP2 MISSION shRNA Bacterial Glycerol Stock
ubiquitin associated protein 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026872.1-2736s21c1
Sequence:CCGGGATGGGAATCTAGCTAATAATCTCGAGATTATTAGCTAGATTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026872.1-4205s21c1
Sequence:CCGGGCCAGTCAGCTCCCTTATAAACTCGAGTTTATAAGGGAGCTGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026872.1-378s1c1
Sequence:CCGGGTGAACAAAGCTATCAATATACTCGAGTATATTGATAGCTTTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216004    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026872.1-3898s1c1
Sequence:CCGGCAATGAAGAATCACGACTTATCTCGAGATAAGTCGTGATTCTTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026872.1-3058s21c1
Sequence:CCGGACGCTTACAGCACAGGTTATGCTCGAGCATAACCTGTGCTGTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026872.1-376s21c1
Sequence:CCGGATGTGAACAAAGCTATCAATACTCGAGTATTGATAGCTTTGTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026872.1-1157s21c1
Sequence:CCGGCACTTCTGCCAGCTCATATTCCTCGAGGAATATGAGCTGGCAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026872.1-1581s1c1
Sequence:CCGGCAGCTTCCTAACATGACTGTTCTCGAGAACAGTCATGTTAGGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026872
VALIDATED
UBAP2 MISSION shRNA shRNA Plasmid DNA
ubiquitin associated protein 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026872.1-2736s21c1
Sequence:CCGGGATGGGAATCTAGCTAATAATCTCGAGATTATTAGCTAGATTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026872.1-4205s21c1
Sequence:CCGGGCCAGTCAGCTCCCTTATAAACTCGAGTTTATAAGGGAGCTGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026872.1-378s1c1
Sequence:CCGGGTGAACAAAGCTATCAATATACTCGAGTATATTGATAGCTTTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216004    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026872.1-3898s1c1
Sequence:CCGGCAATGAAGAATCACGACTTATCTCGAGATAAGTCGTGATTCTTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026872.1-3058s21c1
Sequence:CCGGACGCTTACAGCACAGGTTATGCTCGAGCATAACCTGTGCTGTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026872.1-376s21c1
Sequence:CCGGATGTGAACAAAGCTATCAATACTCGAGTATTGATAGCTTTGTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026872.1-1157s21c1
Sequence:CCGGCACTTCTGCCAGCTCATATTCCTCGAGGAATATGAGCTGGCAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026872.1-1581s1c1
Sequence:CCGGCAGCTTCCTAACATGACTGTTCTCGAGAACAGTCATGTTAGGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026872
VALIDATED
UBAP2 MISSION shRNA Lentiviral Transduction Particles
ubiquitin associated protein 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026872.1-2736s21c1
Sequence:CCGGGATGGGAATCTAGCTAATAATCTCGAGATTATTAGCTAGATTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026872.1-4205s21c1
Sequence:CCGGGCCAGTCAGCTCCCTTATAAACTCGAGTTTATAAGGGAGCTGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026872.1-378s1c1
Sequence:CCGGGTGAACAAAGCTATCAATATACTCGAGTATATTGATAGCTTTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216004    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026872.1-3898s1c1
Sequence:CCGGCAATGAAGAATCACGACTTATCTCGAGATAAGTCGTGATTCTTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026872.1-3058s21c1
Sequence:CCGGACGCTTACAGCACAGGTTATGCTCGAGCATAACCTGTGCTGTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026872.1-376s21c1
Sequence:CCGGATGTGAACAAAGCTATCAATACTCGAGTATTGATAGCTTTGTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026872.1-1157s21c1
Sequence:CCGGCACTTCTGCCAGCTCATATTCCTCGAGGAATATGAGCTGGCAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026872.1-1581s1c1
Sequence:CCGGCAGCTTCCTAACATGACTGTTCTCGAGAACAGTCATGTTAGGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks