EMAIL THIS PAGE TO A FRIEND

UBAP2L

ubiquitin associated protein 2-like

Synonyms: NICE-4
Gene ID:
Mouse(74383) ubiquitin associated protein 2-like
Zebrafish(100034477) ubiquitin associated protein 2-like
chicken(426147) ubiquitin associated protein 2-like
dog(480135) ubiquitin associated protein 2-like
Horse(100056822) ubiquitin associated protein 2-like
domestic cat(101098034) ubiquitin associated protein 2-like
domestic guinea pig(100730762) ubiquitin associated protein 2-like
naked mole-rat(101696880) ubiquitin associated protein 2-like
cow(100125221) ubiquitin associated protein 2-like
sheep(101110012) ubiquitin associated protein 2-like
155 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014847 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014847 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014847 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153489 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153489 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153489 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127320 Rosetta Predictions human pricing
NM_014847 Rosetta Predictions human pricing
NM_028475 Rosetta Predictions mouse pricing
NM_153489 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127320 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329087 predicted 1299
2 SASI_Hs02_00329088 predicted 1994
3 SASI_Hs02_00329089 predicted 345
4 SASI_Hs02_00329090 predicted 762
5 SASI_Hs02_00329091 predicted 1108
6 SASI_Hs02_00329092 predicted 2560
7 SASI_Hs02_00329093 predicted 1120
8 SASI_Hs02_00329094 predicted 1765
9 SASI_Hs02_00329095 predicted 283
10 SASI_Hs02_00329096 predicted 1490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346410 predicted 1353
2 SASI_Hs01_00133294 predicted 2051
3 SASI_Hs01_00133295 predicted 407
4 SASI_Hs01_00133297 predicted 832
5 SASI_Hs01_00133299 predicted 1170
6 SASI_Hs01_00133300 predicted 2616
7 SASI_Hs01_00133301 predicted 1184
8 SASI_Hs01_00133303 predicted 1826
9 SASI_Hs02_00346411 predicted 352
10 SASI_Hs02_00346412 predicted 1553
11 SASI_Hs01_00133296 predicted 2924
12 SASI_Hs01_00133298 predicted 256
13 SASI_Hs01_00133302 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028475 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022715 predicted 343
2 SASI_Mm01_00022716 predicted 2647
3 SASI_Mm01_00022717 predicted 2244
4 SASI_Mm01_00022718 predicted 2179
5 SASI_Mm01_00022719 predicted 2506
6 SASI_Mm01_00022721 predicted 2250
7 SASI_Mm01_00022722 predicted 2624
8 SASI_Mm02_00333924 predicted 2651
9 SASI_Mm01_00022724 predicted 2665
10 SASI_Mm02_00333925 predicted 1454
11 SASI_Mm01_00022720 predicted 2259
12 SASI_Mm01_00022723 predicted 2075
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153489 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094663 predicted 346
2 SASI_Mm01_00094664 predicted 2594
3 SASI_Mm01_00094665 predicted 2185
4 SASI_Mm01_00094666 predicted 2125
5 SASI_Mm01_00094667 predicted 2450
6 SASI_Mm01_00094669 predicted 2186
7 SASI_Mm01_00094670 predicted 2566
8 SASI_Mm02_00343239 predicted 2594
9 SASI_Mm01_00094672 predicted 2608
10 SASI_Mm02_00343240 predicted 1400
11 SASI_Mm01_00094668 predicted 2207
12 SASI_Mm01_00094671 predicted 2010
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014847
VALIDATED
UBAP2L MISSION shRNA Bacterial Glycerol Stock
ubiquitin associated protein 2-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007677    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014847.2-3480s1c1
Sequence:CCGGCCCACCCTGTTGTATGTATTACTCGAGTAATACATACAACAGGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014847.2-1815s1c1
Sequence:CCGGGCCCTCTTTATGAACAGAGATCTCGAGATCTCTGTTCATAAAGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014847.2-671s1c1
Sequence:CCGGGCCAATACTGATGATAACTATCTCGAGATAGTTATCATCAGTATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014847.2-2489s1c1
Sequence:CCGGCCGCCACAAGTATATGGTTATCTCGAGATAACCATATACTTGTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014847.3-2263s21c1
Sequence:CCGGCGCAGCAGAATACCCTTTCATCTCGAGATGAAAGGGTATTCTGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014847.3-789s21c1
Sequence:CCGGGCCAATACTGATGATAACTATCTCGAGATAGTTATCATCAGTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014847.3-3792s21c1
Sequence:CCGGGCCCTAAGTCTCCTTCTTTATCTCGAGATAAAGAAGGAGACTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014847.3-2560s21c1
Sequence:CCGGTGTTGCCTAATCCGTATATTACTCGAGTAATATACGGATTAGGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014847.3-285s21c1
Sequence:CCGGCAGATGATTTCGGACCATAATCTCGAGATTATGGTCCGAAATCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014847
VALIDATED
UBAP2L MISSION shRNA shRNA Plasmid DNA
ubiquitin associated protein 2-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007677    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014847.2-3480s1c1
Sequence:CCGGCCCACCCTGTTGTATGTATTACTCGAGTAATACATACAACAGGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014847.2-1815s1c1
Sequence:CCGGGCCCTCTTTATGAACAGAGATCTCGAGATCTCTGTTCATAAAGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014847.2-671s1c1
Sequence:CCGGGCCAATACTGATGATAACTATCTCGAGATAGTTATCATCAGTATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014847.2-2489s1c1
Sequence:CCGGCCGCCACAAGTATATGGTTATCTCGAGATAACCATATACTTGTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014847.3-2263s21c1
Sequence:CCGGCGCAGCAGAATACCCTTTCATCTCGAGATGAAAGGGTATTCTGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014847.3-789s21c1
Sequence:CCGGGCCAATACTGATGATAACTATCTCGAGATAGTTATCATCAGTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014847.3-3792s21c1
Sequence:CCGGGCCCTAAGTCTCCTTCTTTATCTCGAGATAAAGAAGGAGACTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014847.3-2560s21c1
Sequence:CCGGTGTTGCCTAATCCGTATATTACTCGAGTAATATACGGATTAGGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014847.3-285s21c1
Sequence:CCGGCAGATGATTTCGGACCATAATCTCGAGATTATGGTCCGAAATCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014847
VALIDATED
UBAP2L MISSION shRNA Lentiviral Transduction Particles
ubiquitin associated protein 2-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007677    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014847.2-3480s1c1
Sequence:CCGGCCCACCCTGTTGTATGTATTACTCGAGTAATACATACAACAGGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014847.2-1815s1c1
Sequence:CCGGGCCCTCTTTATGAACAGAGATCTCGAGATCTCTGTTCATAAAGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014847.2-671s1c1
Sequence:CCGGGCCAATACTGATGATAACTATCTCGAGATAGTTATCATCAGTATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014847.2-2489s1c1
Sequence:CCGGCCGCCACAAGTATATGGTTATCTCGAGATAACCATATACTTGTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014847.3-2263s21c1
Sequence:CCGGCGCAGCAGAATACCCTTTCATCTCGAGATGAAAGGGTATTCTGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014847.3-789s21c1
Sequence:CCGGGCCAATACTGATGATAACTATCTCGAGATAGTTATCATCAGTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014847.3-3792s21c1
Sequence:CCGGGCCCTAAGTCTCCTTCTTTATCTCGAGATAAAGAAGGAGACTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014847.3-2560s21c1
Sequence:CCGGTGTTGCCTAATCCGTATATTACTCGAGTAATATACGGATTAGGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014847.3-285s21c1
Sequence:CCGGCAGATGATTTCGGACCATAATCTCGAGATTATGGTCCGAAATCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153489
UBAP2L MISSION shRNA Bacterial Glycerol Stock
ubiquitin associated protein 2-like
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153489.1-2186s1c1
Sequence:CCGGCCACACAACATAGCAGTGCATCTCGAGATGCACTGCTATGTTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153489.1-2042s1c1
Sequence:CCGGCAGTGAAATCTGAATCACCTTCTCGAGAAGGTGATTCAGATTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153489.1-2551s21c1
Sequence:CCGGGCCTATCCGCCACAAGTATATCTCGAGATATACTTGTGGCGGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153489.1-235s1c1
Sequence:CCGGCAGATGATTTCGGACCATAATCTCGAGATTATGGTCCGAAATCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153489.1-1643s1c1
Sequence:CCGGCAGATATCTCAGGGCTAAATCCTCGAGGATTTAGCCCTGAGATATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153489.1-3041s21c1
Sequence:CCGGACACGGGCGTGCCAGATATATCTCGAGATATATCTGGCACGCCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153489.1-2508s21c1
Sequence:CCGGATTGTTGCCTAATCCATATATCTCGAGATATATGGATTAGGCAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153489.1-235s21c1
Sequence:CCGGCAGATGATTTCGGACCATAATCTCGAGATTATGGTCCGAAATCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153489.1-1643s21c1
Sequence:CCGGCAGATATCTCAGGGCTAAATCCTCGAGGATTTAGCCCTGAGATATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153489
UBAP2L MISSION shRNA shRNA Plasmid DNA
ubiquitin associated protein 2-like
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153489.1-2186s1c1
Sequence:CCGGCCACACAACATAGCAGTGCATCTCGAGATGCACTGCTATGTTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153489.1-2042s1c1
Sequence:CCGGCAGTGAAATCTGAATCACCTTCTCGAGAAGGTGATTCAGATTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153489.1-2551s21c1
Sequence:CCGGGCCTATCCGCCACAAGTATATCTCGAGATATACTTGTGGCGGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153489.1-235s1c1
Sequence:CCGGCAGATGATTTCGGACCATAATCTCGAGATTATGGTCCGAAATCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153489.1-1643s1c1
Sequence:CCGGCAGATATCTCAGGGCTAAATCCTCGAGGATTTAGCCCTGAGATATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153489.1-3041s21c1
Sequence:CCGGACACGGGCGTGCCAGATATATCTCGAGATATATCTGGCACGCCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153489.1-2508s21c1
Sequence:CCGGATTGTTGCCTAATCCATATATCTCGAGATATATGGATTAGGCAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153489.1-235s21c1
Sequence:CCGGCAGATGATTTCGGACCATAATCTCGAGATTATGGTCCGAAATCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153489.1-1643s21c1
Sequence:CCGGCAGATATCTCAGGGCTAAATCCTCGAGGATTTAGCCCTGAGATATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153489
UBAP2L MISSION shRNA Lentiviral Transduction Particles
ubiquitin associated protein 2-like
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153489.1-2186s1c1
Sequence:CCGGCCACACAACATAGCAGTGCATCTCGAGATGCACTGCTATGTTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153489.1-2042s1c1
Sequence:CCGGCAGTGAAATCTGAATCACCTTCTCGAGAAGGTGATTCAGATTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153489.1-2551s21c1
Sequence:CCGGGCCTATCCGCCACAAGTATATCTCGAGATATACTTGTGGCGGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153489.1-235s1c1
Sequence:CCGGCAGATGATTTCGGACCATAATCTCGAGATTATGGTCCGAAATCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153489.1-1643s1c1
Sequence:CCGGCAGATATCTCAGGGCTAAATCCTCGAGGATTTAGCCCTGAGATATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153489.1-3041s21c1
Sequence:CCGGACACGGGCGTGCCAGATATATCTCGAGATATATCTGGCACGCCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153489.1-2508s21c1
Sequence:CCGGATTGTTGCCTAATCCATATATCTCGAGATATATGGATTAGGCAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153489.1-235s21c1
Sequence:CCGGCAGATGATTTCGGACCATAATCTCGAGATTATGGTCCGAAATCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153489.1-1643s21c1
Sequence:CCGGCAGATATCTCAGGGCTAAATCCTCGAGGATTTAGCCCTGAGATATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks