EMAIL THIS PAGE TO A FRIEND

UBASH3A

ubiquitin associated and SH3 domain containing A

Synonyms: CLIP4 STS-2 TULA TULA-1
Gene ID:
Human(53347) Summary: This gene encodes one of two family members belonging to the T-cell ubiquitin ligand (TULA) family. Both family members can negatively regulate T-cell signaling. This family member can facilitate growth factor withdrawal-induced apoptosis in T cells, which may occur via its interaction with AIF, an apoptosis-inducing factor. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Mouse(328795) ubiquitin associated and SH3 domain containing, A
Rat(309666) ubiquitin associated and SH3 domain containing, A
cow(514555) ubiquitin associated and SH3 domain containing A
sheep(101104708) ubiquitin associated and SH3 domain containing A
naked mole-rat(101709233) ubiquitin associated and SH3 domain containing A
Domestic Rabbit(100358149) ubiquitin associated and SH3 domain containing A
domestic guinea pig(100722690) ubiquitin associated and SH3 domain containing A
chicken(418535) ubiquitin associated and SH3 domain containing A
dog(487779) ubiquitin associated and SH3 domain containing A
domestic cat(101085062) ubiquitin associated and SH3 domain containing A
Horse(100057923) ubiquitin associated and SH3 domain containing A
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500999 Anti-STS2/TULA (Internal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human, canine
ELISA, immunohistochemistry pricing
U9258 Anti-UBASH3A (336-350) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
U9383 Anti-UBASH3A (531-545) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2501714 Anti-UBASH3A antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB2102618 Anti-UBASH3A antibody produced in rabbit affinity isolated antibody canine, bovine, human, rat, horse, rabbit, mouse
western blot pricing
HPA046983 Anti-UBASH3A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA035367 Anti-UBASH3A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1410972 Anti-UBASH3A antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409449 Monoclonal Anti-UBASH3A antibody produced in mouse clone 1G6, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1403269 Monoclonal Anti-UBASH3A, (C-terminal) antibody produced in mouse clone 4D2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018961 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018961 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018961 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177823 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177823 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177823 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001895 Rosetta Predictions human pricing
NM_018961 Rosetta Predictions human pricing
NM_001107620 Rosetta Predictions rat pricing
NM_177823 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001895 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303984 predicted 198
2 SASI_Hs02_00303985 predicted 818
3 SASI_Hs01_00070612 predicted 1051
4 SASI_Hs01_00070613 predicted 862
5 SASI_Hs01_00070614 predicted 1880
6 SASI_Hs01_00070615 predicted 1321
7 SASI_Hs01_00070616 predicted 805
8 SASI_Hs01_00070617 predicted 980
9 SASI_Hs01_00070618 predicted 1613
10 SASI_Hs01_00070620 predicted 1088
11 SASI_Hs01_00070619 predicted 2005
12 SASI_Hs01_00070621 predicted 1922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352436 predicted 200
2 SASI_Hs02_00352437 predicted 933
3 SASI_Hs01_00093288 predicted 1166
4 SASI_Hs01_00093289 predicted 979
5 SASI_Hs01_00093290 predicted 1999
6 SASI_Hs01_00093291 predicted 1432
7 SASI_Hs01_00093292 predicted 920
8 SASI_Hs01_00093293 predicted 1096
9 SASI_Hs01_00093294 predicted 1728
10 SASI_Hs01_00093296 predicted 1194
11 SASI_Hs01_00093295 predicted 2124
12 SASI_Hs01_00093297 predicted 2043
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107620 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230625 predicted 1915
2 SASI_Rn02_00230626 predicted 2211
3 SASI_Rn02_00230627 predicted 1272
4 SASI_Rn02_00230628 predicted 1136
5 SASI_Rn02_00230629 predicted 2427
6 SASI_Rn02_00230630 predicted 2286
7 SASI_Rn02_00230631 predicted 1390
8 SASI_Rn02_00230632 predicted 1328
9 SASI_Rn02_00230633 predicted 1103
10 SASI_Rn02_00230634 predicted 1837
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177823 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143970 predicted 968
2 SASI_Mm01_00143972 predicted 2005
3 SASI_Mm01_00143973 predicted 1763
4 SASI_Mm01_00143974 predicted 1186
5 SASI_Mm01_00143975 predicted 1606
6 SASI_Mm01_00143976 predicted 978
7 SASI_Mm01_00143977 predicted 1291
8 SASI_Mm02_00348283 predicted 608
9 SASI_Mm01_00143978 predicted 1984
10 SASI_Mm02_00348284 predicted 1679
11 SASI_Mm01_00143971 predicted 873
12 SASI_Mm01_00143979 predicted 561
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018961
VALIDATED
UBASH3A MISSION shRNA Bacterial Glycerol Stock
ubiquitin associated and SH3 domain containing A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018961.2-1626s21c1
Sequence:CCGGAGAGCTGAAAGAGGCAAATTTCTCGAGAAATTTGCCTCTTTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018961.2-2025s21c1
Sequence:CCGGGCCACGGTGATGTTGTCATAACTCGAGTTATGACAACATCACCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018961.2-881s21c1
Sequence:CCGGGAGCCCTATTCCAGTACAAACCTCGAGGTTTGTACTGGAATAGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018961.2-1314s21c1
Sequence:CCGGCTACAGGCCAGACCTGAATTTCTCGAGAAATTCAGGTCTGGCCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018961.2-1771s21c1
Sequence:CCGGGACACGGGTGTCATCCTAATTCTCGAGAATTAGGATGACACCCGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_018961.x-874s1c1
Sequence:CCGGGAGAGCCCTATTCCAGTACAACTCGAGTTGTACTGGAATAGGGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_018961.x-1547s1c1
Sequence:CCGGCGAGTGGAACCTGGAATCTTTCTCGAGAAAGATTCCAGGTTCCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018961.x-652s1c1
Sequence:CCGGCAATTTAACTAGAGCCTCCTTCTCGAGAAGGAGGCTCTAGTTAAATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004487    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018961.x-2420s1c1
Sequence:CCGGTCCATCACTCTTTAGCCATATCTCGAGATATGGCTAAAGAGTGATGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018961.x-1386s1c1
Sequence:CCGGCATTATCATCGTGTGGCATTTCTCGAGAAATGCCACACGATGATAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018961
VALIDATED
UBASH3A MISSION shRNA shRNA Plasmid DNA
ubiquitin associated and SH3 domain containing A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018961.2-1626s21c1
Sequence:CCGGAGAGCTGAAAGAGGCAAATTTCTCGAGAAATTTGCCTCTTTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018961.2-2025s21c1
Sequence:CCGGGCCACGGTGATGTTGTCATAACTCGAGTTATGACAACATCACCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018961.2-881s21c1
Sequence:CCGGGAGCCCTATTCCAGTACAAACCTCGAGGTTTGTACTGGAATAGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018961.2-1314s21c1
Sequence:CCGGCTACAGGCCAGACCTGAATTTCTCGAGAAATTCAGGTCTGGCCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018961.2-1771s21c1
Sequence:CCGGGACACGGGTGTCATCCTAATTCTCGAGAATTAGGATGACACCCGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_018961.x-874s1c1
Sequence:CCGGGAGAGCCCTATTCCAGTACAACTCGAGTTGTACTGGAATAGGGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_018961.x-1547s1c1
Sequence:CCGGCGAGTGGAACCTGGAATCTTTCTCGAGAAAGATTCCAGGTTCCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018961.x-652s1c1
Sequence:CCGGCAATTTAACTAGAGCCTCCTTCTCGAGAAGGAGGCTCTAGTTAAATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004487    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018961.x-2420s1c1
Sequence:CCGGTCCATCACTCTTTAGCCATATCTCGAGATATGGCTAAAGAGTGATGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018961.x-1386s1c1
Sequence:CCGGCATTATCATCGTGTGGCATTTCTCGAGAAATGCCACACGATGATAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018961
VALIDATED
UBASH3A MISSION shRNA Lentiviral Transduction Particles
ubiquitin associated and SH3 domain containing A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018961.2-1626s21c1
Sequence:CCGGAGAGCTGAAAGAGGCAAATTTCTCGAGAAATTTGCCTCTTTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018961.2-2025s21c1
Sequence:CCGGGCCACGGTGATGTTGTCATAACTCGAGTTATGACAACATCACCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018961.2-881s21c1
Sequence:CCGGGAGCCCTATTCCAGTACAAACCTCGAGGTTTGTACTGGAATAGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018961.2-1314s21c1
Sequence:CCGGCTACAGGCCAGACCTGAATTTCTCGAGAAATTCAGGTCTGGCCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018961.2-1771s21c1
Sequence:CCGGGACACGGGTGTCATCCTAATTCTCGAGAATTAGGATGACACCCGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_018961.x-874s1c1
Sequence:CCGGGAGAGCCCTATTCCAGTACAACTCGAGTTGTACTGGAATAGGGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_018961.x-1547s1c1
Sequence:CCGGCGAGTGGAACCTGGAATCTTTCTCGAGAAAGATTCCAGGTTCCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018961.x-652s1c1
Sequence:CCGGCAATTTAACTAGAGCCTCCTTCTCGAGAAGGAGGCTCTAGTTAAATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004487    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018961.x-2420s1c1
Sequence:CCGGTCCATCACTCTTTAGCCATATCTCGAGATATGGCTAAAGAGTGATGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018961.x-1386s1c1
Sequence:CCGGCATTATCATCGTGTGGCATTTCTCGAGAAATGCCACACGATGATAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177823
UBASH3A MISSION shRNA Bacterial Glycerol Stock
ubiquitin associated and SH3 domain containing A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177823.2-2197s1c1
Sequence:CCGGCCTCCTTATTACTATAACCATCTCGAGATGGTTATAGTAATAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177823.2-1445s1c1
Sequence:CCGGGCAAACTTCAATGTTGACCTTCTCGAGAAGGTCAACATTGAAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177823.2-971s1c1
Sequence:CCGGCCGTCAATGTCAAAGAGTGTTCTCGAGAACACTCTTTGACATTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177823.2-1196s1c1
Sequence:CCGGCCGCTATCATCCTGTGGAATTCTCGAGAATTCCACAGGATGATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177823.2-1462s1c1
Sequence:CCGGCCTTGATTATAGGCCAGCATTCTCGAGAATGCTGGCCTATAATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177823
UBASH3A MISSION shRNA shRNA Plasmid DNA
ubiquitin associated and SH3 domain containing A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177823.2-2197s1c1
Sequence:CCGGCCTCCTTATTACTATAACCATCTCGAGATGGTTATAGTAATAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177823.2-1445s1c1
Sequence:CCGGGCAAACTTCAATGTTGACCTTCTCGAGAAGGTCAACATTGAAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177823.2-971s1c1
Sequence:CCGGCCGTCAATGTCAAAGAGTGTTCTCGAGAACACTCTTTGACATTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177823.2-1196s1c1
Sequence:CCGGCCGCTATCATCCTGTGGAATTCTCGAGAATTCCACAGGATGATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177823.2-1462s1c1
Sequence:CCGGCCTTGATTATAGGCCAGCATTCTCGAGAATGCTGGCCTATAATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177823
UBASH3A MISSION shRNA Lentiviral Transduction Particles
ubiquitin associated and SH3 domain containing A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177823.2-2197s1c1
Sequence:CCGGCCTCCTTATTACTATAACCATCTCGAGATGGTTATAGTAATAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177823.2-1445s1c1
Sequence:CCGGGCAAACTTCAATGTTGACCTTCTCGAGAAGGTCAACATTGAAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177823.2-971s1c1
Sequence:CCGGCCGTCAATGTCAAAGAGTGTTCTCGAGAACACTCTTTGACATTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177823.2-1196s1c1
Sequence:CCGGCCGCTATCATCCTGTGGAATTCTCGAGAATTCCACAGGATGATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177823.2-1462s1c1
Sequence:CCGGCCTTGATTATAGGCCAGCATTCTCGAGAATGCTGGCCTATAATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks