EMAIL THIS PAGE TO A FRIEND

UBASH3B

ubiquitin associated and SH3 domain containing B

Synonyms: STS-1 STS1 TULA-2 p70
UniProtKB ID: Q8TF42, Q53GT5, Q53GT8, Q8NBV7, Q96IG9, Q96NZ2
Gene ID:
Human(84959) Summary: This gene encodes a protein that contains a ubiquitin associated domain at the N-terminus, an SH3 domain, and a C-terminal domain with similarities to the catalytic motif of phosphoglycerate mutase. The encoded protein was found to inhibit endocytosis of epidermal growth factor receptor (EGFR) and platelet-derived growth factor receptor. [provided by RefSeq, Jul 2008]
Mouse(72828) ubiquitin associated and SH3 domain containing, B
Rat(315579) ubiquitin associated and SH3 domain containing, B
chicken(419748) ubiquitin associated and SH3 domain containing B
dog(489355) ubiquitin associated and SH3 domain containing B
Horse(100063571) ubiquitin associated and SH3 domain containing B
domestic cat(101100245) ubiquitin associated and SH3 domain containing B
domestic guinea pig(100721999) ubiquitin associated and SH3 domain containing B
naked mole-rat(101711182) ubiquitin associated and SH3 domain containing B
cow(523809) ubiquitin associated and SH3 domain containing B
sheep(101111654) ubiquitin associated and SH3 domain containing B
267 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176860 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176860 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176860 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032873 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032873 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032873 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032873 Rosetta Predictions human pricing
XM_001065047 Rosetta Predictions rat pricing
XM_236104 Rosetta Predictions rat pricing
NM_176860 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032873 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101375 predicted 846
2 SASI_Hs01_00101376 predicted 1611
3 SASI_Hs01_00101377 predicted 1946
4 SASI_Hs01_00101378 predicted 2067
5 SASI_Hs01_00101379 predicted 657
6 SASI_Hs01_00101380 predicted 1284
7 SASI_Hs01_00101382 predicted 2238
8 SASI_Hs01_00101383 predicted 1237
9 SASI_Hs01_00101384 predicted 1702
10 SASI_Hs02_00360488 predicted 1733
11 SASI_Hs01_00101381 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065047 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312689 predicted 2506
2 SASI_Rn02_00312690 predicted 2363
3 SASI_Rn02_00312691 predicted 1957
4 SASI_Rn02_00312692 predicted 2141
5 SASI_Rn02_00312693 predicted 1145
6 SASI_Rn02_00312694 predicted 1705
7 SASI_Rn02_00312695 predicted 2004
8 SASI_Rn02_00312696 predicted 2239
9 SASI_Rn02_00312697 predicted 1402
10 SASI_Rn02_00312698 predicted 2701
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236104 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389843 predicted 2513
2 SASI_Rn02_00389844 predicted 2363
3 SASI_Rn02_00389845 predicted 1959
4 SASI_Rn02_00389846 predicted 2147
5 SASI_Rn02_00389847 predicted 1146
6 SASI_Rn02_00389848 predicted 1699
7 SASI_Rn02_00389849 predicted 2004
8 SASI_Rn02_00389850 predicted 2241
9 SASI_Rn02_00389851 predicted 1404
10 SASI_Rn02_00389852 predicted 2695
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176860 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346779 predicted 1686
2 SASI_Mm01_00119764 predicted 1742
3 SASI_Mm01_00119765 predicted 1342
4 SASI_Mm01_00119766 predicted 528
5 SASI_Mm01_00119767 predicted 1011
6 SASI_Mm01_00119768 predicted 1375
7 SASI_Mm01_00119769 predicted 1643
8 SASI_Mm01_00119770 predicted 798
9 SASI_Mm01_00119771 predicted 585
10 SASI_Mm01_00119772 predicted 1071
11 SASI_Mm01_00119763 predicted 1290
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176860
VALIDATED
UBASH3B MISSION shRNA Bacterial Glycerol Stock
ubiquitin associated and SH3 domain containing B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176860.3-2082s1c1
Sequence:CCGGGCTCAGAATCATTTAGCATATCTCGAGATATGCTAAATGATTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176860.3-1871s1c1
Sequence:CCGGCCTGCGAAGAATTGGGAGAAACTCGAGTTTCTCCCAATTCTTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176860.3-767s1c1
Sequence:CCGGCCACCATATTCTCTCGGGATACTCGAGTATCCCGAGAGAATATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176860.3-1457s1c1
Sequence:CCGGGCGTTCAGACTGCACATAATACTCGAGTATTATGTGCAGTCTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176860.3-1025s1c1
Sequence:CCGGCCATCCTAAATACCGTATCATCTCGAGATGATACGGTATTTAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176860
VALIDATED
UBASH3B MISSION shRNA shRNA Plasmid DNA
ubiquitin associated and SH3 domain containing B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176860.3-2082s1c1
Sequence:CCGGGCTCAGAATCATTTAGCATATCTCGAGATATGCTAAATGATTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176860.3-1871s1c1
Sequence:CCGGCCTGCGAAGAATTGGGAGAAACTCGAGTTTCTCCCAATTCTTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176860.3-767s1c1
Sequence:CCGGCCACCATATTCTCTCGGGATACTCGAGTATCCCGAGAGAATATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176860.3-1457s1c1
Sequence:CCGGGCGTTCAGACTGCACATAATACTCGAGTATTATGTGCAGTCTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176860.3-1025s1c1
Sequence:CCGGCCATCCTAAATACCGTATCATCTCGAGATGATACGGTATTTAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176860
VALIDATED
UBASH3B MISSION shRNA Lentiviral Transduction Particles
ubiquitin associated and SH3 domain containing B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176860.3-2082s1c1
Sequence:CCGGGCTCAGAATCATTTAGCATATCTCGAGATATGCTAAATGATTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176860.3-1871s1c1
Sequence:CCGGCCTGCGAAGAATTGGGAGAAACTCGAGTTTCTCCCAATTCTTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176860.3-767s1c1
Sequence:CCGGCCACCATATTCTCTCGGGATACTCGAGTATCCCGAGAGAATATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176860.3-1457s1c1
Sequence:CCGGGCGTTCAGACTGCACATAATACTCGAGTATTATGTGCAGTCTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176860.3-1025s1c1
Sequence:CCGGCCATCCTAAATACCGTATCATCTCGAGATGATACGGTATTTAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032873
VALIDATED
UBASH3B MISSION shRNA Bacterial Glycerol Stock
ubiquitin associated and SH3 domain containing B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_032873.2-930s1c1
Sequence:CCGGCCTCATAAGAAGCAGCTACATCTCGAGATGTAGCTGCTTCTTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_032873.2-1241s1c1
Sequence:CCGGGCCTGAGAATTACATTACCAACTCGAGTTGGTAATGTAATTCTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_032873.2-2149s1c1
Sequence:CCGGCCTGTGAAGAATTAGGAGAAACTCGAGTTTCTCCTAATTCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032873.2-1804s1c1
Sequence:CCGGCCGGCTTATTTGAGTGGACAACTCGAGTTGTCCACTCAAATAAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_032873.2-1735s1c1
Sequence:CCGGGCGTTCAGACTGCACACAATACTCGAGTATTGTGTGCAGTCTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032873.4-1644s21c1
Sequence:CCGGGAGTGGTGGTTTCCGAGATTACTCGAGTAATCTCGGAAACCACCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032873.4-1315s21c1
Sequence:CCGGGAATGCAGCACCTGGATATTTCTCGAGAAATATCCAGGTGCTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032873.4-1728s21c1
Sequence:CCGGATTAGAGAGCAATACCATTATCTCGAGATAATGGTATTGCTCTCTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032873.4-2142s21c1
Sequence:CCGGCTCCAAGGACTTCGTACAAATCTCGAGATTTGTACGAAGTCCTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032873.4-2423s21c1
Sequence:CCGGCATATTTCCTTTCACACTTAACTCGAGTTAAGTGTGAAAGGAAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032873
VALIDATED
UBASH3B MISSION shRNA shRNA Plasmid DNA
ubiquitin associated and SH3 domain containing B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_032873.2-930s1c1
Sequence:CCGGCCTCATAAGAAGCAGCTACATCTCGAGATGTAGCTGCTTCTTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_032873.2-1241s1c1
Sequence:CCGGGCCTGAGAATTACATTACCAACTCGAGTTGGTAATGTAATTCTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_032873.2-2149s1c1
Sequence:CCGGCCTGTGAAGAATTAGGAGAAACTCGAGTTTCTCCTAATTCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032873.2-1804s1c1
Sequence:CCGGCCGGCTTATTTGAGTGGACAACTCGAGTTGTCCACTCAAATAAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_032873.2-1735s1c1
Sequence:CCGGGCGTTCAGACTGCACACAATACTCGAGTATTGTGTGCAGTCTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032873.4-1644s21c1
Sequence:CCGGGAGTGGTGGTTTCCGAGATTACTCGAGTAATCTCGGAAACCACCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032873.4-1315s21c1
Sequence:CCGGGAATGCAGCACCTGGATATTTCTCGAGAAATATCCAGGTGCTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032873.4-1728s21c1
Sequence:CCGGATTAGAGAGCAATACCATTATCTCGAGATAATGGTATTGCTCTCTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032873.4-2142s21c1
Sequence:CCGGCTCCAAGGACTTCGTACAAATCTCGAGATTTGTACGAAGTCCTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032873.4-2423s21c1
Sequence:CCGGCATATTTCCTTTCACACTTAACTCGAGTTAAGTGTGAAAGGAAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032873
VALIDATED
UBASH3B MISSION shRNA Lentiviral Transduction Particles
ubiquitin associated and SH3 domain containing B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_032873.2-930s1c1
Sequence:CCGGCCTCATAAGAAGCAGCTACATCTCGAGATGTAGCTGCTTCTTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_032873.2-1241s1c1
Sequence:CCGGGCCTGAGAATTACATTACCAACTCGAGTTGGTAATGTAATTCTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_032873.2-2149s1c1
Sequence:CCGGCCTGTGAAGAATTAGGAGAAACTCGAGTTTCTCCTAATTCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032873.2-1804s1c1
Sequence:CCGGCCGGCTTATTTGAGTGGACAACTCGAGTTGTCCACTCAAATAAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_032873.2-1735s1c1
Sequence:CCGGGCGTTCAGACTGCACACAATACTCGAGTATTGTGTGCAGTCTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032873.4-1644s21c1
Sequence:CCGGGAGTGGTGGTTTCCGAGATTACTCGAGTAATCTCGGAAACCACCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032873.4-1315s21c1
Sequence:CCGGGAATGCAGCACCTGGATATTTCTCGAGAAATATCCAGGTGCTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032873.4-1728s21c1
Sequence:CCGGATTAGAGAGCAATACCATTATCTCGAGATAATGGTATTGCTCTCTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032873.4-2142s21c1
Sequence:CCGGCTCCAAGGACTTCGTACAAATCTCGAGATTTGTACGAAGTCCTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032873.4-2423s21c1
Sequence:CCGGCATATTTCCTTTCACACTTAACTCGAGTTAAGTGTGAAAGGAAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks