EMAIL THIS PAGE TO A FRIEND

UBB

ubiquitin B

Gene ID:
Human(7314) Summary: This gene encodes ubiquitin, one of the most conserved proteins known. Ubiquitin is required for ATP-dependent, nonlysosomal intracellular protein degradation of abnormal proteins and normal proteins with a rapid turnover. Ubiquitin is covalently bound to proteins to be degraded, and presumably labels these proteins for degradation. Ubiquitin also binds to histone H2A in actively transcribed regions but does not cause histone H2A degradation, suggesting that ubiquitin is also involved in regulation of gene expression. This gene consists of three direct repeats of the ubiquitin coding sequence with no spacer sequence. Consequently, the protein is expressed as a polyubiquitin precursor with a final amino acid after the last repeat. Aberrant form of this protein has been noticed in patients with Alzheimer's and Down syndrome. [provided by RefSeq, Jul 2008]
Mouse(22187) ubiquitin B
Rat(192255) ubiquitin B
cow(281370) ubiquitin B
Zebrafish(550134) ubiquitin B
chicken(396190) ubiquitin B
Horse(100049794) ubiquitin B
dog(479513) ubiquitin B
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018955 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018955 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018955 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011664 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011664 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011664 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
ABS1513 Anti-phospho-Ubiquitin Antibody (Ser65) 100 µL, Anti-phospho-Ubiquitin Antibody (Ser65) is an antibody against phospho-Ubiquitin (Ser65) for use in Western Blotting and Immunocytochemistry. pricing
ABS1513-I-AF488 Anti-phospho-Ubiquitin Antibody (Ser65), Alexa Fluor® 488 Conjugate 100 µL, Detect ubiquitin Ser65 phosphorylation using this rabbit polyclonal Anti-phospho-Ubiquitin (Ser65) Antibody, Alexa Fluor® 488 Conjugate, Cat. No. ABS1513-I-AF488, validated for use in Immunocytochemistry. pricing
07-375 Anti-Ubiquitin Antibody 200 µg, This Anti-Ubiquitin Antibody is validated for use in WB for the detection of Ubiquitin. pricing
AB1586 Anti-Ubiquitin Antibody 100 µL, Detect Ubiquitin using this Anti-Ubiquitin Antibody validated for use in WB, IH. pricing
AB1690 Anti-Ubiquitin Antibody 50 µL, Anti-Ubiquitin Antibody detects level of Ubiquitin & has been published & validated for use in WB, IH, IH(P). pricing
05-944 Anti-Ubiquitin Antibody, clone P4D1-A11 100 µg, Anti-Ubiquitin Antibody, clone P4D1-A11 is an antibody against Ubiquitin for use in WB. pricing
MAB1510 Anti-Ubiquitin Antibody, clone Ubi-1 (aka 042691GS) 100 µL, This Anti-Ubiquitin Antibody, clone Ubi-1 (aka 042691GS) is validated for use in IH(P), IP, WB for the detection of Ubiquitin. pricing
05-1313 Anti-Ubiquitin Antibody, Lys63-Specific, clone HWA4C4 100 µg, Anti-Ubiquitin Antibody, Lys63-Specific, clone HWA4C4 is an antibody against Ubiquitin for use in ELISA, IH, IC & WB. pricing
05-1307-AF488 Anti-Ubiquitin, Lys48-Specific, clone Apu2, Alexa Fluor® 488 conjugate 100 µL, This Anti-Ubiquitin, Lys48-Specific, clone Apu2, Alexa Fluor® 488 conjugate is validated for use in Immunocytochemistry for the detection of Ubiquitin. pricing
MABS486 Anti-Ubiquitin (pan) Antibody, clone 2G7B8 100 μg, Detect Ubiquitin using this Anti-Ubiquitin (pan) Antibody, clone 2G7B8 validated for use in Western Blotting. pricing
19-203 Epoxomicin Inhibitor 100 µg, The Epoxomicin Inhibitor controls the biological activity of Epoxomicin. This small molecule/inhibitor is primarily used for Biochemicals applications. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018955 Rosetta Predictions human pricing
NM_138895 Rosetta Predictions rat pricing
NM_011664 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201423 predicted 519
2 SASI_Hs01_00201424 predicted 672
3 SASI_Hs01_00201425 predicted 295
4 SASI_Hs01_00201426 predicted 281
5 SASI_Hs01_00201427 predicted 295
6 SASI_Hs01_00201428 predicted 258
7 SASI_Hs01_00201429 predicted 348
8 SASI_Hs01_00201430 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138895 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033882 predicted 348
2 SASI_Rn01_00033884 predicted 455
3 SASI_Rn01_00033881 predicted 685
4 SASI_Rn01_00033885 predicted 966
5 SASI_Rn01_00033886 predicted 1051
6 SASI_Rn01_00033887 predicted 1012
7 SASI_Rn02_00268344 predicted 1007
8 SASI_Rn01_00033883 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011664 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321171 predicted 385
2 SASI_Mm01_00198888 predicted 938
3 SASI_Mm02_00321172 predicted 823
4 SASI_Mm01_00198889 predicted 942
5 SASI_Mm01_00198890 predicted 1081
6 SASI_Mm01_00198891 predicted 1040
7 SASI_Mm01_00198892 predicted 1040
8 SASI_Mm02_00321173 predicted 136
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018955
VALIDATED
UBB MISSION shRNA Bacterial Glycerol Stock
ubiquitin B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018955.2-287s21c1
Sequence:CCGGTGGAAGATGGCCGTACTCTTTCTCGAGAAAGAGTACGGCCATCTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018955.2-517s21c1
Sequence:CCGGGAAGATGGCCGCACTCTTTCTCTCGAGAGAAAGAGTGCGGCCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018955.2-380s21c1
Sequence:CCGGTGAAGACCCTGACCGGCAAGACTCGAGTCTTGCCGGTCAGGGTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018955.2-348s1c1
Sequence:CCGGCCTGCGTCTGAGAGGTGGTATCTCGAGATACCACCTCTCAGACGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018955.2-670s1c1
Sequence:CCGGGTGAAGGCCAAGATCCAAGATCTCGAGATCTTGGATCTTGGCCTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018955.2-297s1c1
Sequence:CCGGCCGTACTCTTTCTGACTACAACTCGAGTTGTAGTCAGAAAGAGTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018955.2-448s1c1
Sequence:CCGGGCCAAGATCCAGGATAAAGAACTCGAGTTCTTTATCCTGGATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018955.2-753s1c1
Sequence:CCGGCCGCACTCTTTCTGACTACAACTCGAGTTGTAGTCAGAAAGAGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018955
VALIDATED
UBB MISSION shRNA shRNA Plasmid DNA
ubiquitin B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018955.2-287s21c1
Sequence:CCGGTGGAAGATGGCCGTACTCTTTCTCGAGAAAGAGTACGGCCATCTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018955.2-517s21c1
Sequence:CCGGGAAGATGGCCGCACTCTTTCTCTCGAGAGAAAGAGTGCGGCCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018955.2-380s21c1
Sequence:CCGGTGAAGACCCTGACCGGCAAGACTCGAGTCTTGCCGGTCAGGGTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018955.2-348s1c1
Sequence:CCGGCCTGCGTCTGAGAGGTGGTATCTCGAGATACCACCTCTCAGACGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018955.2-670s1c1
Sequence:CCGGGTGAAGGCCAAGATCCAAGATCTCGAGATCTTGGATCTTGGCCTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018955.2-297s1c1
Sequence:CCGGCCGTACTCTTTCTGACTACAACTCGAGTTGTAGTCAGAAAGAGTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018955.2-448s1c1
Sequence:CCGGGCCAAGATCCAGGATAAAGAACTCGAGTTCTTTATCCTGGATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018955.2-753s1c1
Sequence:CCGGCCGCACTCTTTCTGACTACAACTCGAGTTGTAGTCAGAAAGAGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018955
VALIDATED
UBB MISSION shRNA Lentiviral Transduction Particles
ubiquitin B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018955.2-287s21c1
Sequence:CCGGTGGAAGATGGCCGTACTCTTTCTCGAGAAAGAGTACGGCCATCTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018955.2-517s21c1
Sequence:CCGGGAAGATGGCCGCACTCTTTCTCTCGAGAGAAAGAGTGCGGCCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018955.2-380s21c1
Sequence:CCGGTGAAGACCCTGACCGGCAAGACTCGAGTCTTGCCGGTCAGGGTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018955.2-348s1c1
Sequence:CCGGCCTGCGTCTGAGAGGTGGTATCTCGAGATACCACCTCTCAGACGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018955.2-670s1c1
Sequence:CCGGGTGAAGGCCAAGATCCAAGATCTCGAGATCTTGGATCTTGGCCTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018955.2-297s1c1
Sequence:CCGGCCGTACTCTTTCTGACTACAACTCGAGTTGTAGTCAGAAAGAGTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018955.2-448s1c1
Sequence:CCGGGCCAAGATCCAGGATAAAGAACTCGAGTTCTTTATCCTGGATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018955.2-753s1c1
Sequence:CCGGCCGCACTCTTTCTGACTACAACTCGAGTTGTAGTCAGAAAGAGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011664
VALIDATED
UBB MISSION shRNA Bacterial Glycerol Stock
ubiquitin B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011664.1-947s1c1
Sequence:CCGGCCGCACTCTCTCTGATTACAACTCGAGTTGTAATCAGAGAGAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011664.1-497s1c1
Sequence:CCGGCCTCTCTGATTACAACATCCACTCGAGTGGATGTTGTAATCAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011664.1-854s1c1
Sequence:CCGGCATCGAGAATGTGAAGGCCAACTCGAGTTGGCCTTCACATTCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011664.1-265s1c1
Sequence:CCGGGCACCCTCTCTGATTACAACACTCGAGTGTTGTAATCAGAGAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011664.1-857s1c1
Sequence:CCGGCGAGAATGTGAAGGCCAAGATCTCGAGATCTTGGCCTTCACATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011664
VALIDATED
UBB MISSION shRNA shRNA Plasmid DNA
ubiquitin B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011664.1-947s1c1
Sequence:CCGGCCGCACTCTCTCTGATTACAACTCGAGTTGTAATCAGAGAGAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011664.1-497s1c1
Sequence:CCGGCCTCTCTGATTACAACATCCACTCGAGTGGATGTTGTAATCAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011664.1-854s1c1
Sequence:CCGGCATCGAGAATGTGAAGGCCAACTCGAGTTGGCCTTCACATTCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011664.1-265s1c1
Sequence:CCGGGCACCCTCTCTGATTACAACACTCGAGTGTTGTAATCAGAGAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011664.1-857s1c1
Sequence:CCGGCGAGAATGTGAAGGCCAAGATCTCGAGATCTTGGCCTTCACATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011664
VALIDATED
UBB MISSION shRNA Lentiviral Transduction Particles
ubiquitin B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011664.1-947s1c1
Sequence:CCGGCCGCACTCTCTCTGATTACAACTCGAGTTGTAATCAGAGAGAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011664.1-497s1c1
Sequence:CCGGCCTCTCTGATTACAACATCCACTCGAGTGGATGTTGTAATCAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011664.1-854s1c1
Sequence:CCGGCATCGAGAATGTGAAGGCCAACTCGAGTTGGCCTTCACATTCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011664.1-265s1c1
Sequence:CCGGGCACCCTCTCTGATTACAACACTCGAGTGTTGTAATCAGAGAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011664.1-857s1c1
Sequence:CCGGCGAGAATGTGAAGGCCAAGATCTCGAGATCTTGGCCTTCACATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks