EMAIL THIS PAGE TO A FRIEND

UBD

ubiquitin D

Synonyms: FAT10 GABBR1 UBD-3
UniProtKB ID: O15205, B0UZT6, Q5STL2, Q5SUK2, Q96EC7
Gene ID:
Mouse(24108) ubiquitin D
Rat(29168) ubiquitin D
cow(512938) ubiquitin D
128 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006398 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006398 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006398 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023137 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023137 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023137 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU037091 MISSION® esiRNA esiRNA targeting mouse Ubd (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006398 Rosetta Predictions human pricing
NM_053299 Rosetta Predictions rat pricing
NM_023137 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006398 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178207 predicted 313
2 SASI_Hs02_00341474 predicted 611
3 SASI_Hs01_00178208 predicted 276
4 SASI_Hs01_00178209 predicted 608
5 SASI_Hs01_00178210 predicted 394
6 SASI_Hs01_00178212 predicted 650
7 SASI_Hs01_00178213 predicted 665
8 SASI_Hs01_00178214 predicted 268
9 SASI_Hs01_00178215 predicted 568
10 SASI_Hs01_00178216 predicted 581
11 SASI_Hs01_00178211 predicted 645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053299 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070597 predicted 411
2 SASI_Rn01_00070598 predicted 343
3 SASI_Rn02_00265683 predicted 347
4 SASI_Rn01_00070599 predicted 265
5 SASI_Rn01_00070600 predicted 372
6 SASI_Rn01_00070601 predicted 291
7 SASI_Rn01_00070602 predicted 420
8 SASI_Rn01_00070603 predicted 376
9 SASI_Rn01_00070604 predicted 435
10 SASI_Rn01_00070605 predicted 431
11 SASI_Rn01_00070606 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023137 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043621 predicted 767
2 SASI_Mm01_00043622 predicted 519
3 SASI_Mm01_00043624 predicted 472
4 SASI_Mm01_00043625 predicted 500
5 SASI_Mm01_00043627 predicted 726
6 SASI_Mm01_00043628 predicted 394
7 SASI_Mm01_00043629 predicted 699
8 SASI_Mm01_00043630 predicted 398
9 SASI_Mm02_00326854 predicted 577
10 SASI_Mm02_00326855 predicted 447
11 SASI_Mm01_00043623 predicted 634
12 SASI_Mm01_00043626 predicted 461
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006398
UBD MISSION shRNA Bacterial Glycerol Stock
ubiquitin D
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006398.3-326s21c1
Sequence:CCGGAGAACATGTCCGGTCTAAGACCTCGAGGTCTTAGACCGGACATGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006398.3-822s21c1
Sequence:CCGGGAATGAGATGAGTAGAGTAAGCTCGAGCTTACTCTACTCATCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006398.3-415s21c1
Sequence:CCGGCATCTTATGGCATTGACAAAGCTCGAGCTTTGTCAATGCCATAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006398.3-504s21c1
Sequence:CCGGGAGTCAGGTGATGAGGCAAAGCTCGAGCTTTGCCTCATCACCTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006398.3-670s21c1
Sequence:CCGGGCATCAGAAAGGGCAACTTACCTCGAGGTAAGTTGCCCTTTCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006398.1-580s1c1
Sequence:CCGGCGAACACATCTTCTGATGATTCTCGAGAATCATCAGAAGATGTGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006398.1-67s1c1
Sequence:CCGGTGGGATTTAATGACCTTTGATCTCGAGATCAAAGGTCATTAAATCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006398.1-171s1c1
Sequence:CCGGGCTGGGCTCCAAGATCTTAAACTCGAGTTTAAGATCTTGGAGCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006398.1-243s1c1
Sequence:CCGGCCTTACCCTGAAAGTGGTGAACTCGAGTTCACCACTTTCAGGGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006398.1-375s1c1
Sequence:CCGGCGAGACTAAGACGGGTATAATCTCGAGATTATACCCGTCTTAGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006398
UBD MISSION shRNA shRNA Plasmid DNA
ubiquitin D
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006398.3-326s21c1
Sequence:CCGGAGAACATGTCCGGTCTAAGACCTCGAGGTCTTAGACCGGACATGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006398.3-822s21c1
Sequence:CCGGGAATGAGATGAGTAGAGTAAGCTCGAGCTTACTCTACTCATCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006398.3-415s21c1
Sequence:CCGGCATCTTATGGCATTGACAAAGCTCGAGCTTTGTCAATGCCATAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006398.3-504s21c1
Sequence:CCGGGAGTCAGGTGATGAGGCAAAGCTCGAGCTTTGCCTCATCACCTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006398.3-670s21c1
Sequence:CCGGGCATCAGAAAGGGCAACTTACCTCGAGGTAAGTTGCCCTTTCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006398.1-580s1c1
Sequence:CCGGCGAACACATCTTCTGATGATTCTCGAGAATCATCAGAAGATGTGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006398.1-67s1c1
Sequence:CCGGTGGGATTTAATGACCTTTGATCTCGAGATCAAAGGTCATTAAATCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006398.1-171s1c1
Sequence:CCGGGCTGGGCTCCAAGATCTTAAACTCGAGTTTAAGATCTTGGAGCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006398.1-243s1c1
Sequence:CCGGCCTTACCCTGAAAGTGGTGAACTCGAGTTCACCACTTTCAGGGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006398.1-375s1c1
Sequence:CCGGCGAGACTAAGACGGGTATAATCTCGAGATTATACCCGTCTTAGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006398
UBD MISSION shRNA Lentiviral Transduction Particles
ubiquitin D
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006398.3-326s21c1
Sequence:CCGGAGAACATGTCCGGTCTAAGACCTCGAGGTCTTAGACCGGACATGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006398.3-822s21c1
Sequence:CCGGGAATGAGATGAGTAGAGTAAGCTCGAGCTTACTCTACTCATCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006398.3-415s21c1
Sequence:CCGGCATCTTATGGCATTGACAAAGCTCGAGCTTTGTCAATGCCATAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006398.3-504s21c1
Sequence:CCGGGAGTCAGGTGATGAGGCAAAGCTCGAGCTTTGCCTCATCACCTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006398.3-670s21c1
Sequence:CCGGGCATCAGAAAGGGCAACTTACCTCGAGGTAAGTTGCCCTTTCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006398.1-580s1c1
Sequence:CCGGCGAACACATCTTCTGATGATTCTCGAGAATCATCAGAAGATGTGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006398.1-67s1c1
Sequence:CCGGTGGGATTTAATGACCTTTGATCTCGAGATCAAAGGTCATTAAATCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006398.1-171s1c1
Sequence:CCGGGCTGGGCTCCAAGATCTTAAACTCGAGTTTAAGATCTTGGAGCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006398.1-243s1c1
Sequence:CCGGCCTTACCCTGAAAGTGGTGAACTCGAGTTCACCACTTTCAGGGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006398.1-375s1c1
Sequence:CCGGCGAGACTAAGACGGGTATAATCTCGAGATTATACCCGTCTTAGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023137
UBD MISSION shRNA Bacterial Glycerol Stock
ubiquitin D
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023137.2-824s1c1
Sequence:CCGGCAACATCAAGAGTGGCAGTTTCTCGAGAAACTGCCACTCTTGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023137.2-569s1c1
Sequence:CCGGGTCATCCTATGGGATTGACAACTCGAGTTGTCAATCCCATAGGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023137.2-753s1c1
Sequence:CCGGGTGATCCCTAAGAAGCAGGTTCTCGAGAACCTGCTTCTTAGGGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023137.2-816s1c1
Sequence:CCGGGCTGACTACAACATCAAGAGTCTCGAGACTCTTGATGTTGTAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023137.2-418s1c1
Sequence:CCGGGTTCAGACCAATGGCGGTTAACTCGAGTTAACCGCCATTGGTCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023137
UBD MISSION shRNA shRNA Plasmid DNA
ubiquitin D
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023137.2-824s1c1
Sequence:CCGGCAACATCAAGAGTGGCAGTTTCTCGAGAAACTGCCACTCTTGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023137.2-569s1c1
Sequence:CCGGGTCATCCTATGGGATTGACAACTCGAGTTGTCAATCCCATAGGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023137.2-753s1c1
Sequence:CCGGGTGATCCCTAAGAAGCAGGTTCTCGAGAACCTGCTTCTTAGGGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023137.2-816s1c1
Sequence:CCGGGCTGACTACAACATCAAGAGTCTCGAGACTCTTGATGTTGTAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023137.2-418s1c1
Sequence:CCGGGTTCAGACCAATGGCGGTTAACTCGAGTTAACCGCCATTGGTCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023137
UBD MISSION shRNA Lentiviral Transduction Particles
ubiquitin D
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023137.2-824s1c1
Sequence:CCGGCAACATCAAGAGTGGCAGTTTCTCGAGAAACTGCCACTCTTGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023137.2-569s1c1
Sequence:CCGGGTCATCCTATGGGATTGACAACTCGAGTTGTCAATCCCATAGGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023137.2-753s1c1
Sequence:CCGGGTGATCCCTAAGAAGCAGGTTCTCGAGAACCTGCTTCTTAGGGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023137.2-816s1c1
Sequence:CCGGGCTGACTACAACATCAAGAGTCTCGAGACTCTTGATGTTGTAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023137.2-418s1c1
Sequence:CCGGGTTCAGACCAATGGCGGTTAACTCGAGTTAACCGCCATTGGTCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks