EMAIL THIS PAGE TO A FRIEND

UBE2A

ubiquitin-conjugating enzyme E2A

Synonyms: HHR6A MRXS30 MRXSN RAD6A UBC2
Gene ID:
Human(7319) Summary: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is required for post-replicative DNA damage repair. Multiple alternatively spliced transcript variants have been found for this gene and they encode distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(22209) ubiquitin-conjugating enzyme E2A
Rat(298317) ubiquitin-conjugating enzyme E2A
Zebrafish(797853) ubiquitin-conjugating enzyme E2A (RAD6 homolog)
chicken(395672) ubiquitin-conjugating enzyme E2A
dog(492095) ubiquitin-conjugating enzyme E2A
domestic cat(101083326) ubiquitin-conjugating enzyme E2A
Horse(100058679) ubiquitin-conjugating enzyme E2A
domestic guinea pig(100715223) ubiquitin-conjugating enzyme E2A
naked mole-rat(101698111) ubiquitin-conjugating enzyme E2A
cow(282107) ubiquitin-conjugating enzyme E2A
sheep(101105312) ubiquitin-conjugating enzyme E2A
151 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003336 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003336 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003336 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019668 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019668 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019668 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003336 Rosetta Predictions human pricing
NM_181762 Rosetta Predictions human pricing
NM_181777 Rosetta Predictions human pricing
NM_001013933 Rosetta Predictions rat pricing
NM_019668 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003336 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056615 predicted 774
2 SASI_Hs02_00335488 predicted 1032
3 SASI_Hs01_00056617 predicted 833
4 SASI_Hs01_00056618 predicted 958
5 SASI_Hs01_00056619 predicted 1060
6 SASI_Hs01_00056620 predicted 1027
7 SASI_Hs01_00056621 predicted 694
8 SASI_Hs01_00056622 predicted 812
9 SASI_Hs01_00056623 predicted 967
10 SASI_Hs01_00056624 predicted 968
11 SASI_Hs01_00056616 predicted 699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181762 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110420 predicted 683
2 SASI_Hs02_00370362 predicted 939
3 SASI_Hs01_00110422 predicted 739
4 SASI_Hs01_00110423 predicted 861
5 SASI_Hs01_00110424 predicted 971
6 SASI_Hs01_00110425 predicted 938
7 SASI_Hs01_00110426 predicted 606
8 SASI_Hs01_00110427 predicted 726
9 SASI_Hs01_00110428 predicted 881
10 SASI_Hs01_00110429 predicted 884
11 SASI_Hs01_00110421 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181777 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226460 predicted 1623
2 SASI_Hs02_00370374 predicted 1869
3 SASI_Hs01_00226462 predicted 1680
4 SASI_Hs01_00226463 predicted 1800
5 SASI_Hs01_00226464 predicted 1906
6 SASI_Hs01_00226465 predicted 1872
7 SASI_Hs01_00226466 predicted 1543
8 SASI_Hs01_00226467 predicted 1660
9 SASI_Hs01_00226468 predicted 1811
10 SASI_Hs01_00226469 predicted 1819
11 SASI_Hs01_00226461 predicted 1542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013933 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034322 predicted 308
2 SASI_Rn01_00034323 predicted 421
3 SASI_Rn01_00034324 predicted 456
4 SASI_Rn01_00034325 predicted 398
5 SASI_Rn01_00034326 predicted 491
6 SASI_Rn01_00034327 predicted 685
7 SASI_Rn01_00034328 predicted 235
8 SASI_Rn01_00034329 predicted 269
9 SASI_Rn01_00034330 predicted 371
10 SASI_Rn01_00034331 predicted 315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019668 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135966 predicted 373
2 SASI_Mm01_00135967 predicted 411
3 SASI_Mm01_00135968 predicted 434
4 SASI_Mm01_00135969 predicted 254
5 SASI_Mm01_00135970 predicted 350
6 SASI_Mm02_00324731 predicted 446
7 SASI_Mm01_00135971 predicted 639
8 SASI_Mm01_00135972 predicted 269
9 SASI_Mm01_00135973 predicted 219
10 SASI_Mm01_00135974 predicted 333
11 SASI_Mm01_00135975 predicted 625
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003336
VALIDATED
UBE2A MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003336.x-523s1c1
Sequence:CCGGCCAATCCCAATAGTCCAGCAACTCGAGTTGCTGGACTATTGGGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003336.x-566s1c1
Sequence:CCGGCCAGGAGAACAAACGGGAATACTCGAGTATTCCCGTTTGTTCTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003336.x-487s1c1
Sequence:CCGGCCATTCTAACATCCATACAGTCTCGAGACTGTATGGATGTTAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003336.x-483s1c1
Sequence:CCGGTCTTCCATTCTAACATCCATACTCGAGTATGGATGTTAGAATGGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003336.x-694s1c1
Sequence:CCGGACCTCCCTACTCCTGTCATTACTCGAGTAATGACAGGAGTAGGGAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003336.2-611s21c1
Sequence:CCGGAGAACAAAGCTGGCGTGATTGCTCGAGCAATCACGCCAGCTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003336.2-694s21c1
Sequence:CCGGACCTCCCTACTCCTGTCATTACTCGAGTAATGACAGGAGTAGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003336.2-417s21c1
Sequence:CCGGGTCTATGCAGATGGTAGTATACTCGAGTATACTACCATCTGCATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003336.2-315s21c1
Sequence:CCGGCCGTTTGAGGATGGAACATTTCTCGAGAAATGTTCCATCCTCAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003336.2-277s21c1
Sequence:CCGGTGGTGTGGAACGCGGTCATTTCTCGAGAAATGACCGCGTTCCACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003336
VALIDATED
UBE2A MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003336.x-523s1c1
Sequence:CCGGCCAATCCCAATAGTCCAGCAACTCGAGTTGCTGGACTATTGGGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003336.x-566s1c1
Sequence:CCGGCCAGGAGAACAAACGGGAATACTCGAGTATTCCCGTTTGTTCTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003336.x-487s1c1
Sequence:CCGGCCATTCTAACATCCATACAGTCTCGAGACTGTATGGATGTTAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003336.x-483s1c1
Sequence:CCGGTCTTCCATTCTAACATCCATACTCGAGTATGGATGTTAGAATGGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003336.x-694s1c1
Sequence:CCGGACCTCCCTACTCCTGTCATTACTCGAGTAATGACAGGAGTAGGGAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003336.2-611s21c1
Sequence:CCGGAGAACAAAGCTGGCGTGATTGCTCGAGCAATCACGCCAGCTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003336.2-694s21c1
Sequence:CCGGACCTCCCTACTCCTGTCATTACTCGAGTAATGACAGGAGTAGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003336.2-417s21c1
Sequence:CCGGGTCTATGCAGATGGTAGTATACTCGAGTATACTACCATCTGCATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003336.2-315s21c1
Sequence:CCGGCCGTTTGAGGATGGAACATTTCTCGAGAAATGTTCCATCCTCAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003336.2-277s21c1
Sequence:CCGGTGGTGTGGAACGCGGTCATTTCTCGAGAAATGACCGCGTTCCACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003336
VALIDATED
UBE2A MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003336.x-523s1c1
Sequence:CCGGCCAATCCCAATAGTCCAGCAACTCGAGTTGCTGGACTATTGGGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003336.x-566s1c1
Sequence:CCGGCCAGGAGAACAAACGGGAATACTCGAGTATTCCCGTTTGTTCTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003336.x-487s1c1
Sequence:CCGGCCATTCTAACATCCATACAGTCTCGAGACTGTATGGATGTTAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003336.x-483s1c1
Sequence:CCGGTCTTCCATTCTAACATCCATACTCGAGTATGGATGTTAGAATGGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003336.x-694s1c1
Sequence:CCGGACCTCCCTACTCCTGTCATTACTCGAGTAATGACAGGAGTAGGGAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003336.2-611s21c1
Sequence:CCGGAGAACAAAGCTGGCGTGATTGCTCGAGCAATCACGCCAGCTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003336.2-694s21c1
Sequence:CCGGACCTCCCTACTCCTGTCATTACTCGAGTAATGACAGGAGTAGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003336.2-417s21c1
Sequence:CCGGGTCTATGCAGATGGTAGTATACTCGAGTATACTACCATCTGCATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003336.2-315s21c1
Sequence:CCGGCCGTTTGAGGATGGAACATTTCTCGAGAAATGTTCCATCCTCAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003336.2-277s21c1
Sequence:CCGGTGGTGTGGAACGCGGTCATTTCTCGAGAAATGACCGCGTTCCACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019668
VALIDATED
UBE2A MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2A
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019668.2-204s1c1
Sequence:CCGGCGGAGAACAACATAATGGTTTCTCGAGAAACCATTATGTTGTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019668.3-511s21c1
Sequence:CCGGCAGGAGAACAAGCGGGAATATCTCGAGATATTCCCGCTTGTTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019668.3-361s21c1
Sequence:CCGGGTCTATGCAGATGGTAGTATACTCGAGTATACTACCATCTGCATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019668.3-259s21c1
Sequence:CCGGCCGTTTGAGGATGGAACATTTCTCGAGAAATGTTCCATCCTCAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019668.3-451s21c1
Sequence:CCGGTCTCTATTGGATGAACCTAATCTCGAGATTAGGTTCATCCAATAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019668.3-627s21c1
Sequence:CCGGTGATGCATTTATCACCTTATTCTCGAGAATAAGGTGATAAATGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019668
VALIDATED
UBE2A MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2A
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019668.2-204s1c1
Sequence:CCGGCGGAGAACAACATAATGGTTTCTCGAGAAACCATTATGTTGTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019668.3-511s21c1
Sequence:CCGGCAGGAGAACAAGCGGGAATATCTCGAGATATTCCCGCTTGTTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019668.3-361s21c1
Sequence:CCGGGTCTATGCAGATGGTAGTATACTCGAGTATACTACCATCTGCATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019668.3-259s21c1
Sequence:CCGGCCGTTTGAGGATGGAACATTTCTCGAGAAATGTTCCATCCTCAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019668.3-451s21c1
Sequence:CCGGTCTCTATTGGATGAACCTAATCTCGAGATTAGGTTCATCCAATAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019668.3-627s21c1
Sequence:CCGGTGATGCATTTATCACCTTATTCTCGAGAATAAGGTGATAAATGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019668
VALIDATED
UBE2A MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2A
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019668.2-204s1c1
Sequence:CCGGCGGAGAACAACATAATGGTTTCTCGAGAAACCATTATGTTGTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019668.3-511s21c1
Sequence:CCGGCAGGAGAACAAGCGGGAATATCTCGAGATATTCCCGCTTGTTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019668.3-361s21c1
Sequence:CCGGGTCTATGCAGATGGTAGTATACTCGAGTATACTACCATCTGCATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019668.3-259s21c1
Sequence:CCGGCCGTTTGAGGATGGAACATTTCTCGAGAAATGTTCCATCCTCAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019668.3-451s21c1
Sequence:CCGGTCTCTATTGGATGAACCTAATCTCGAGATTAGGTTCATCCAATAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019668.3-627s21c1
Sequence:CCGGTGATGCATTTATCACCTTATTCTCGAGAATAAGGTGATAAATGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks