EMAIL THIS PAGE TO A FRIEND

UBE2B

ubiquitin-conjugating enzyme E2B

Synonyms: E2-17kDa HHR6B HR6B RAD6B UBC2
UniProtKB ID: P63146, B2R503, D3DQA2, P23567, Q4PJ15, Q9D0J6
Gene ID:
Human(7320) Summary: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is required for post-replicative DNA damage repair. Its protein sequence is 100% identical to the mouse, rat, and rabbit homologs, which indicates that this enzyme is highly conserved in eukaryotic evolution. [provided by RefSeq, Jul 2008]
Mouse(22210) ubiquitin-conjugating enzyme E2B
Rat(81816) ubiquitin-conjugating enzyme E2B
cow(512207) ubiquitin-conjugating enzyme E2B
sheep(100381250) ubiquitin-conjugating enzyme E2B
naked mole-rat(101706676) ubiquitin-conjugating enzyme E2B
Domestic Rabbit(100009132) ubiquitin-conjugating enzyme E2B
domestic guinea pig(100713340) ubiquitin-conjugating enzyme E2B
Zebrafish(437020) ubiquitin-conjugating enzyme E2B (RAD6 homolog)
domestic cat(101099525) ubiquitin-conjugating enzyme E2B
dog(474683) ubiquitin-conjugating enzyme E2B
175 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009458 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009458 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009458 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003337 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003337 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003337 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU045931 MISSION® esiRNA esiRNA human UBE2B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003337 Rosetta Predictions human pricing
NM_031138 Rosetta Predictions rat pricing
NM_009458 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017234 predicted 747
2 SASI_Hs01_00017235 predicted 1349
3 SASI_Hs01_00017236 predicted 1351
4 SASI_Hs01_00017237 predicted 691
5 SASI_Hs01_00017238 predicted 1346
6 SASI_Hs01_00017239 predicted 1346
7 SASI_Hs01_00017240 predicted 740
8 SASI_Hs01_00017241 predicted 1366
9 SASI_Hs01_00017242 predicted 689
10 SASI_Hs01_00017243 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031138 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085175 predicted 706
2 SASI_Rn02_00264470 predicted 475
3 SASI_Rn01_00085176 predicted 753
4 SASI_Rn02_00264471 predicted 675
5 SASI_Rn01_00085178 predicted 579
6 SASI_Rn02_00264472 predicted 704
7 SASI_Rn01_00085180 predicted 579
8 SASI_Rn02_00264473 predicted 611
9 SASI_Rn02_00264474 predicted 751
10 SASI_Rn02_00264475 predicted 978
11 SASI_Rn01_00085177 predicted 933
12 SASI_Rn01_00085179 predicted 912
13 SASI_Rn01_00085181 predicted 375
14 SASI_Rn01_00085182 predicted 912
15 SASI_Rn01_00085183 predicted 682
16 SASI_Rn01_00085184 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009458 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149337 predicted 327
2 SASI_Mm01_00149338 predicted 930
3 SASI_Mm01_00149339 predicted 319
4 SASI_Mm01_00149342 predicted 351
5 SASI_Mm01_00149340 predicted 290
6 SASI_Mm02_00316175 predicted 531
7 SASI_Mm02_00316176 predicted 715
8 SASI_Mm02_00316177 predicted 562
9 SASI_Mm01_00149344 predicted 655
10 SASI_Mm01_00149345 predicted 477
11 SASI_Mm01_00149341 predicted 231
12 SASI_Mm01_00149343 predicted 315
13 SASI_Mm01_00149346 predicted 159
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009458
VALIDATED
UBE2B MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2B
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009458.4-974s21c1
Sequence:CCGGATTACGTGTAAAGCTGTTAAACTCGAGTTTAACAGCTTTACACGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009458.4-268s21c1
Sequence:CCGGACCCTTTGAAGATGGTACTTTCTCGAGAAAGTACCATCTTCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009458.4-158s21c1
Sequence:CCGGATGCGGGATTTCAAGCGATTGCTCGAGCAATCGCTTGAAATCCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009458.4-568s21c1
Sequence:CCGGGCAAAGCTGGAATGATTCATACTCGAGTATGAATCATTCCAGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009458.4-765s21c1
Sequence:CCGGGCATGGTGTGAACTAAGTTATCTCGAGATAACTTAGTTCACACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009458.4-499s21c1
Sequence:CCGGCAGCCAAGCAGCACAGCTTTACTCGAGTAAAGCTGTGCTGCTTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009458.4-533s21c1
Sequence:CCGGCGGGAGTATGAGAAGAGAGTTCTCGAGAACTCTCTTCTCATACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009458.2-454s1c1
Sequence:CCGGCGGGAGTATGAGAAGAGAGTTCTCGAGAACTCTCTTCTCATACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009458.2-387s1c1
Sequence:CCGGGCTGGATGAACCGAATCCAAACTCGAGTTTGGATTCGGTTCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009458.2-152s1c1
Sequence:CCGGTGCAGTGGAATGCAGTTATATCTCGAGATATAACTGCATTCCACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009458.2-489s1c1
Sequence:CCGGGCAAAGCTGGAATGATTCATACTCGAGTATGAATCATTCCAGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009458.2-287s1c1
Sequence:CCGGCAAATGTGTATGCTGATGGTACTCGAGTACCATCAGCATACACATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009458
VALIDATED
UBE2B MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2B
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009458.4-974s21c1
Sequence:CCGGATTACGTGTAAAGCTGTTAAACTCGAGTTTAACAGCTTTACACGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009458.4-268s21c1
Sequence:CCGGACCCTTTGAAGATGGTACTTTCTCGAGAAAGTACCATCTTCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009458.4-158s21c1
Sequence:CCGGATGCGGGATTTCAAGCGATTGCTCGAGCAATCGCTTGAAATCCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009458.4-568s21c1
Sequence:CCGGGCAAAGCTGGAATGATTCATACTCGAGTATGAATCATTCCAGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009458.4-765s21c1
Sequence:CCGGGCATGGTGTGAACTAAGTTATCTCGAGATAACTTAGTTCACACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009458.4-499s21c1
Sequence:CCGGCAGCCAAGCAGCACAGCTTTACTCGAGTAAAGCTGTGCTGCTTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009458.4-533s21c1
Sequence:CCGGCGGGAGTATGAGAAGAGAGTTCTCGAGAACTCTCTTCTCATACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009458.2-454s1c1
Sequence:CCGGCGGGAGTATGAGAAGAGAGTTCTCGAGAACTCTCTTCTCATACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009458.2-387s1c1
Sequence:CCGGGCTGGATGAACCGAATCCAAACTCGAGTTTGGATTCGGTTCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009458.2-152s1c1
Sequence:CCGGTGCAGTGGAATGCAGTTATATCTCGAGATATAACTGCATTCCACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009458.2-489s1c1
Sequence:CCGGGCAAAGCTGGAATGATTCATACTCGAGTATGAATCATTCCAGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009458.2-287s1c1
Sequence:CCGGCAAATGTGTATGCTGATGGTACTCGAGTACCATCAGCATACACATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009458
VALIDATED
UBE2B MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2B
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009458.4-974s21c1
Sequence:CCGGATTACGTGTAAAGCTGTTAAACTCGAGTTTAACAGCTTTACACGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009458.4-268s21c1
Sequence:CCGGACCCTTTGAAGATGGTACTTTCTCGAGAAAGTACCATCTTCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009458.4-158s21c1
Sequence:CCGGATGCGGGATTTCAAGCGATTGCTCGAGCAATCGCTTGAAATCCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009458.4-568s21c1
Sequence:CCGGGCAAAGCTGGAATGATTCATACTCGAGTATGAATCATTCCAGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009458.4-765s21c1
Sequence:CCGGGCATGGTGTGAACTAAGTTATCTCGAGATAACTTAGTTCACACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009458.4-499s21c1
Sequence:CCGGCAGCCAAGCAGCACAGCTTTACTCGAGTAAAGCTGTGCTGCTTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009458.4-533s21c1
Sequence:CCGGCGGGAGTATGAGAAGAGAGTTCTCGAGAACTCTCTTCTCATACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009458.2-454s1c1
Sequence:CCGGCGGGAGTATGAGAAGAGAGTTCTCGAGAACTCTCTTCTCATACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009458.2-387s1c1
Sequence:CCGGGCTGGATGAACCGAATCCAAACTCGAGTTTGGATTCGGTTCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009458.2-152s1c1
Sequence:CCGGTGCAGTGGAATGCAGTTATATCTCGAGATATAACTGCATTCCACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009458.2-489s1c1
Sequence:CCGGGCAAAGCTGGAATGATTCATACTCGAGTATGAATCATTCCAGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009458.2-287s1c1
Sequence:CCGGCAAATGTGTATGCTGATGGTACTCGAGTACCATCAGCATACACATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003337
VALIDATED
UBE2B MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000272874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003337.2-856s21c1
Sequence:CCGGCAAAGCTGGAATGATTCATAACTCGAGTTATGAATCATTCCAGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003337.2-1054s21c1
Sequence:CCGGGCATGGTGTGAACTAAGTTATCTCGAGATAACTTAGTTCACACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003337.2-529s21c1
Sequence:CCGGGCAGTTATATTTGGACCAGAACTCGAGTTCTGGTCCAAATATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003337.2-448s21c1
Sequence:CCGGCGGGATTTCAAGCGGTTACAACTCGAGTTGTAACCGCTTGAAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003337.2-717s21c1
Sequence:CCGGTGATGTATCTTCTATCTTAACCTCGAGGTTAAGATAGAAGATACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003337.x-2596s1c1
Sequence:CCGGGCTTTAATTGTGTGGTGCTTTCTCGAGAAAGCACCACACAATTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003337.x-444s1c1
Sequence:CCGGCATGCGGGATTTCAAGCGGTTCTCGAGAACCGCTTGAAATCCCGCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003337.x-529s1c1
Sequence:CCGGGCAGTTATATTTGGACCAGAACTCGAGTTCTGGTCCAAATATAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003337.x-448s1c1
Sequence:CCGGCGGGATTTCAAGCGGTTACAACTCGAGTTGTAACCGCTTGAAATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003337.x-765s1c1
Sequence:CCGGGAATCCTAACAGTCCAGCCAACTCGAGTTGGCTGGACTGTTAGGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003337
VALIDATED
UBE2B MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000272874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003337.2-856s21c1
Sequence:CCGGCAAAGCTGGAATGATTCATAACTCGAGTTATGAATCATTCCAGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003337.2-1054s21c1
Sequence:CCGGGCATGGTGTGAACTAAGTTATCTCGAGATAACTTAGTTCACACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003337.2-529s21c1
Sequence:CCGGGCAGTTATATTTGGACCAGAACTCGAGTTCTGGTCCAAATATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003337.2-448s21c1
Sequence:CCGGCGGGATTTCAAGCGGTTACAACTCGAGTTGTAACCGCTTGAAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003337.2-717s21c1
Sequence:CCGGTGATGTATCTTCTATCTTAACCTCGAGGTTAAGATAGAAGATACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003337.x-2596s1c1
Sequence:CCGGGCTTTAATTGTGTGGTGCTTTCTCGAGAAAGCACCACACAATTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003337.x-444s1c1
Sequence:CCGGCATGCGGGATTTCAAGCGGTTCTCGAGAACCGCTTGAAATCCCGCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003337.x-529s1c1
Sequence:CCGGGCAGTTATATTTGGACCAGAACTCGAGTTCTGGTCCAAATATAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003337.x-448s1c1
Sequence:CCGGCGGGATTTCAAGCGGTTACAACTCGAGTTGTAACCGCTTGAAATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003337.x-765s1c1
Sequence:CCGGGAATCCTAACAGTCCAGCCAACTCGAGTTGGCTGGACTGTTAGGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003337
VALIDATED
UBE2B MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000272874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003337.2-856s21c1
Sequence:CCGGCAAAGCTGGAATGATTCATAACTCGAGTTATGAATCATTCCAGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003337.2-1054s21c1
Sequence:CCGGGCATGGTGTGAACTAAGTTATCTCGAGATAACTTAGTTCACACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003337.2-529s21c1
Sequence:CCGGGCAGTTATATTTGGACCAGAACTCGAGTTCTGGTCCAAATATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003337.2-448s21c1
Sequence:CCGGCGGGATTTCAAGCGGTTACAACTCGAGTTGTAACCGCTTGAAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003337.2-717s21c1
Sequence:CCGGTGATGTATCTTCTATCTTAACCTCGAGGTTAAGATAGAAGATACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003337.x-2596s1c1
Sequence:CCGGGCTTTAATTGTGTGGTGCTTTCTCGAGAAAGCACCACACAATTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003337.x-444s1c1
Sequence:CCGGCATGCGGGATTTCAAGCGGTTCTCGAGAACCGCTTGAAATCCCGCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003337.x-529s1c1
Sequence:CCGGGCAGTTATATTTGGACCAGAACTCGAGTTCTGGTCCAAATATAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003337.x-448s1c1
Sequence:CCGGCGGGATTTCAAGCGGTTACAACTCGAGTTGTAACCGCTTGAAATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003337.x-765s1c1
Sequence:CCGGGAATCCTAACAGTCCAGCCAACTCGAGTTGGCTGGACTGTTAGGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks