EMAIL THIS PAGE TO A FRIEND

UBE2C

ubiquitin-conjugating enzyme E2C

Synonyms: UBCH10 dJ447F3.2
UniProtKB ID: O00762, A6NP33, E1P5N7, G3XAB7
Gene ID:
Human(11065) Summary: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is required for the destruction of mitotic cyclins and for cell cycle progression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
Mouse(68612) ubiquitin-conjugating enzyme E2C
Rat(296368) ubiquitin-conjugating enzyme E2C
cow(506962) ubiquitin-conjugating enzyme E2C
sheep(101115053) ubiquitin-conjugating enzyme E2C
domestic guinea pig(100718665) ubiquitin-conjugating enzyme E2C
naked mole-rat(101724369) ubiquitin-conjugating enzyme E2C
Zebrafish(566441) ubiquitin-conjugating enzyme E2C
dog(485898) ubiquitin-conjugating enzyme E2C
Horse(100056334) ubiquitin-conjugating enzyme E2C
domestic cat(101087052) ubiquitin-conjugating enzyme E2C
chicken(100859413) ubiquitin-conjugating enzyme E2C
143 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
U1009 Anti-UBE2C (141-155) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
U1134 Anti-UBE2C (156-170) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV43090 Anti-UBE2C (AB1) antibody produced in rabbit affinity isolated antibody rabbit, mouse, zebrafish, horse, canine, human, rat, bovine, guinea pig
western blot pricing
AV43091 Anti-UBE2C (AB2) antibody produced in rabbit affinity isolated antibody human, bovine, canine, horse, mouse, rat, guinea pig, rabbit
western blot pricing
SAB2501954 Anti-UBE2C antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse, canine, rat, bovine
ELISA, western blot pricing
HPA054975 Anti-UBE2C antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA034569 Anti-UBE2C antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB2501079 Anti-UBE2C/UBCH10 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
WH0011065M1 Monoclonal Anti-UBE2C antibody produced in mouse clone 9D3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404894 Monoclonal Anti-UBE2C antibody produced in mouse clone 3B1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007019 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007019 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007019 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026785 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026785 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026785 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU077521 MISSION® esiRNA esiRNA human UBE2C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007019 Rosetta Predictions human pricing
NM_181799 Rosetta Predictions human pricing
NM_181800 Rosetta Predictions human pricing
NM_181801 Rosetta Predictions human pricing
NM_181802 Rosetta Predictions human pricing
NM_181803 Rosetta Predictions human pricing
NM_001106542 Rosetta Predictions rat pricing
NM_026785 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007019 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219473 predicted 471
2 SASI_Hs01_00219474 predicted 500
3 SASI_Hs01_00219475 predicted 456
4 SASI_Hs01_00219476 predicted 482
5 SASI_Hs01_00219478 predicted 491
6 SASI_Hs01_00219480 predicted 468
7 SASI_Hs01_00219481 predicted 481
8 SASI_Hs02_00342781 predicted 447
9 SASI_Hs02_00342782 predicted 455
10 SASI_Hs01_00219472 predicted 489
11 SASI_Hs01_00219477 predicted 444
12 SASI_Hs01_00219479 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181799 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241286 predicted 238
2 SASI_Hs01_00241287 predicted 441
3 SASI_Hs01_00241288 predicted 224
4 SASI_Hs01_00241289 predicted 414
5 SASI_Hs01_00241290 predicted 311
6 SASI_Hs01_00241291 predicted 202
7 SASI_Hs01_00241292 predicted 198
8 SASI_Hs01_00241293 predicted 406
9 SASI_Hs01_00241295 predicted 317
10 SASI_Hs02_00370401 predicted 222
11 SASI_Hs01_00241294 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181800 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131514 predicted 414
2 SASI_Hs01_00131515 predicted 280
3 SASI_Hs01_00131517 predicted 258
4 SASI_Hs01_00131518 predicted 667
5 SASI_Hs01_00131519 predicted 598
6 SASI_Hs01_00131520 predicted 185
7 SASI_Hs01_00131521 predicted 371
8 SASI_Hs01_00131522 predicted 259
9 SASI_Hs01_00131523 predicted 671
10 SASI_Hs02_00370402 predicted 667
11 SASI_Hs01_00131516 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085633 predicted 597
2 SASI_Hs01_00085634 predicted 326
3 SASI_Hs01_00085635 predicted 436
4 SASI_Hs01_00085636 predicted 851
5 SASI_Hs01_00085637 predicted 781
6 SASI_Hs01_00085638 predicted 557
7 SASI_Hs01_00085639 predicted 436
8 SASI_Hs01_00085640 predicted 299
9 SASI_Hs01_00085641 predicted 851
10 SASI_Hs02_00370403 predicted 291
11 SASI_Hs01_00085642 predicted 857
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113347 predicted 1139
2 SASI_Hs01_00113348 predicted 872
3 SASI_Hs01_00113349 predicted 985
4 SASI_Hs01_00113350 predicted 1391
5 SASI_Hs01_00113351 predicted 1330
6 SASI_Hs01_00113352 predicted 1101
7 SASI_Hs01_00113353 predicted 979
8 SASI_Hs01_00113354 predicted 844
9 SASI_Hs01_00113355 predicted 1398
10 SASI_Hs02_00370404 predicted 835
11 SASI_Hs01_00113356 predicted 1397
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181803 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156339 predicted 203
2 SASI_Hs01_00156340 predicted 192
3 SASI_Hs01_00156341 predicted 209
4 SASI_Hs01_00156342 predicted 201
5 SASI_Hs01_00156343 predicted 332
6 SASI_Hs01_00156344 predicted 341
7 SASI_Hs01_00156345 predicted 397
8 SASI_Hs01_00156346 predicted 460
9 SASI_Hs01_00156347 predicted 109
10 SASI_Hs01_00156348 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106542 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219978 predicted 264
2 SASI_Rn02_00219979 predicted 226
3 SASI_Rn02_00219980 predicted 341
4 SASI_Rn02_00219981 predicted 212
5 SASI_Rn02_00219982 predicted 313
6 SASI_Rn02_00219983 predicted 414
7 SASI_Rn02_00219984 predicted 269
8 SASI_Rn02_00219985 predicted 409
9 SASI_Rn02_00219986 predicted 334
10 SASI_Rn02_00219987 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026785 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330876 predicted 472
2 SASI_Mm02_00330877 predicted 405
3 SASI_Mm02_00330878 predicted 309
4 SASI_Mm02_00330879 predicted 205
5 SASI_Mm02_00330880 predicted 577
6 SASI_Mm02_00330881 predicted 648
7 SASI_Mm02_00330882 predicted 538
8 SASI_Mm02_00330883 predicted 633
9 SASI_Mm02_00330884 predicted 427
10 SASI_Mm02_00330885 predicted 401
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007019
VALIDATED
UBE2C MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2C
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007019.x-211s1c1
Sequence:CCGGTGTCTGGCGATAAAGGGATTTCTCGAGAAATCCCTTTATCGCCAGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007019.x-575s1c1
Sequence:CCGGCCTGCAAGAAACCTACTCAAACTCGAGTTTGAGTAGGTTTCTTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007019.x-290s1c1
Sequence:CCGGTGGAACAGTATATGAAGACCTCTCGAGAGGTCTTCATATACTGTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007019.x-347s1c1
Sequence:CCGGCCCTTACAATGCGCCCACAGTCTCGAGACTGTGGGCGCATTGTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_007019.2-634s21c1
Sequence:CCGGGCCTGTCCTTGTGTCGTCTTTCTCGAGAAAGACGACACAAGGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007019.2-347s21c1
Sequence:CCGGCCCTTACAATGCGCCCACAGTCTCGAGACTGTGGGCGCATTGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007019.2-290s21c1
Sequence:CCGGTGGAACAGTATATGAAGACCTCTCGAGAGGTCTTCATATACTGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007019.2-575s21c1
Sequence:CCGGCCTGCAAGAAACCTACTCAAACTCGAGTTTGAGTAGGTTTCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007019.2-454s21c1
Sequence:CCGGTGTATGATGTCAGGACCATTCCTCGAGGAATGGTCCTGACATCATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007019
VALIDATED
UBE2C MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2C
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007019.x-211s1c1
Sequence:CCGGTGTCTGGCGATAAAGGGATTTCTCGAGAAATCCCTTTATCGCCAGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007019.x-575s1c1
Sequence:CCGGCCTGCAAGAAACCTACTCAAACTCGAGTTTGAGTAGGTTTCTTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007019.x-290s1c1
Sequence:CCGGTGGAACAGTATATGAAGACCTCTCGAGAGGTCTTCATATACTGTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007019.x-347s1c1
Sequence:CCGGCCCTTACAATGCGCCCACAGTCTCGAGACTGTGGGCGCATTGTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_007019.2-634s21c1
Sequence:CCGGGCCTGTCCTTGTGTCGTCTTTCTCGAGAAAGACGACACAAGGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007019.2-347s21c1
Sequence:CCGGCCCTTACAATGCGCCCACAGTCTCGAGACTGTGGGCGCATTGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007019.2-290s21c1
Sequence:CCGGTGGAACAGTATATGAAGACCTCTCGAGAGGTCTTCATATACTGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007019.2-575s21c1
Sequence:CCGGCCTGCAAGAAACCTACTCAAACTCGAGTTTGAGTAGGTTTCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007019.2-454s21c1
Sequence:CCGGTGTATGATGTCAGGACCATTCCTCGAGGAATGGTCCTGACATCATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007019
VALIDATED
UBE2C MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2C
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007019.x-211s1c1
Sequence:CCGGTGTCTGGCGATAAAGGGATTTCTCGAGAAATCCCTTTATCGCCAGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007019.x-575s1c1
Sequence:CCGGCCTGCAAGAAACCTACTCAAACTCGAGTTTGAGTAGGTTTCTTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007019.x-290s1c1
Sequence:CCGGTGGAACAGTATATGAAGACCTCTCGAGAGGTCTTCATATACTGTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007019.x-347s1c1
Sequence:CCGGCCCTTACAATGCGCCCACAGTCTCGAGACTGTGGGCGCATTGTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_007019.2-634s21c1
Sequence:CCGGGCCTGTCCTTGTGTCGTCTTTCTCGAGAAAGACGACACAAGGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007019.2-347s21c1
Sequence:CCGGCCCTTACAATGCGCCCACAGTCTCGAGACTGTGGGCGCATTGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007019.2-290s21c1
Sequence:CCGGTGGAACAGTATATGAAGACCTCTCGAGAGGTCTTCATATACTGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007019.2-575s21c1
Sequence:CCGGCCTGCAAGAAACCTACTCAAACTCGAGTTTGAGTAGGTTTCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007019.2-454s21c1
Sequence:CCGGTGTATGATGTCAGGACCATTCCTCGAGGAATGGTCCTGACATCATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026785
UBE2C MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026785.2-409s21c1
Sequence:CCGGGATAAGTGGTCTGCACTATATCTCGAGATATAGTGCAGACCACTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026785.2-543s21c1
Sequence:CCGGATACCTGCAAGAAACCTATTCCTCGAGGAATAGGTTTCTTGCAGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026785.2-643s21c1
Sequence:CCGGTCTGTCCTTTCTCCTTGATTTCTCGAGAAATCAAGGAGAAAGGACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026785.2-176s21c1
Sequence:CCGGTCATGACATCTGGTGACAAAGCTCGAGCTTTGTCACCAGATGTCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026785.2-271s21c1
Sequence:CCGGTATGAAGACCTGAGGTACAAACTCGAGTTTGTACCTCAGGTCTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026785
UBE2C MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026785.2-409s21c1
Sequence:CCGGGATAAGTGGTCTGCACTATATCTCGAGATATAGTGCAGACCACTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026785.2-543s21c1
Sequence:CCGGATACCTGCAAGAAACCTATTCCTCGAGGAATAGGTTTCTTGCAGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026785.2-643s21c1
Sequence:CCGGTCTGTCCTTTCTCCTTGATTTCTCGAGAAATCAAGGAGAAAGGACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026785.2-176s21c1
Sequence:CCGGTCATGACATCTGGTGACAAAGCTCGAGCTTTGTCACCAGATGTCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026785.2-271s21c1
Sequence:CCGGTATGAAGACCTGAGGTACAAACTCGAGTTTGTACCTCAGGTCTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026785
UBE2C MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026785.2-409s21c1
Sequence:CCGGGATAAGTGGTCTGCACTATATCTCGAGATATAGTGCAGACCACTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026785.2-543s21c1
Sequence:CCGGATACCTGCAAGAAACCTATTCCTCGAGGAATAGGTTTCTTGCAGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026785.2-643s21c1
Sequence:CCGGTCTGTCCTTTCTCCTTGATTTCTCGAGAAATCAAGGAGAAAGGACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026785.2-176s21c1
Sequence:CCGGTCATGACATCTGGTGACAAAGCTCGAGCTTTGTCACCAGATGTCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026785.2-271s21c1
Sequence:CCGGTATGAAGACCTGAGGTACAAACTCGAGTTTGTACCTCAGGTCTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks