EMAIL THIS PAGE TO A FRIEND

UBE2D1

ubiquitin-conjugating enzyme E2D 1

Synonyms: E2(17)KB1 SFT UBC4/5 UBCH5 UBCH5A
UniProtKB ID: P51668, A6NLF6, A8K786
Gene ID:
Human(7321) Summary: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is closely related to a stimulator of iron transport (SFT), and is up-regulated in hereditary hemochromatosis. It also functions in the ubiquitination of the tumor-suppressor protein p53 and the hypoxia-inducible transcription factor HIF1alpha by interacting with the E1 ubiquitin-activating enzyme and the E3 ubiquitin-protein ligases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
Mouse(216080) ubiquitin-conjugating enzyme E2D 1
Rat(361831) ubiquitin-conjugating enzyme E2D 1
chicken(423641) ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)
dog(608578) ubiquitin-conjugating enzyme E2D 1
Horse(100062598) ubiquitin-conjugating enzyme E2D 1
cow(535287) ubiquitin-conjugating enzyme E2D 1
sheep(101120209) ubiquitin-conjugating enzyme E2D 1
Goat(100861089) ubiquitin-conjugating enzyme E2D 1
naked mole-rat(101698794) ubiquitin-conjugating enzyme E2D 1
domestic guinea pig(100734273) ubiquitin-conjugating enzyme E2D 1
157 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145420 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145420 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145420 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003338 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003338 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003338 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003338 Rosetta Predictions human pricing
NM_001108530 Rosetta Predictions rat pricing
NM_145420 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003338 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156911 predicted 831
2 SASI_Hs01_00156912 predicted 578
3 SASI_Hs01_00156913 predicted 349
4 SASI_Hs01_00156914 predicted 537
5 SASI_Hs01_00156915 predicted 864
6 SASI_Hs01_00156916 predicted 490
7 SASI_Hs01_00156917 predicted 727
8 SASI_Hs01_00156918 predicted 874
9 SASI_Hs01_00156919 predicted 478
10 SASI_Hs02_00335489 predicted 632
11 SASI_Hs01_00156920 predicted 725
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108530 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239549 predicted 218
2 SASI_Rn02_00239550 predicted 333
3 SASI_Rn02_00239551 predicted 379
4 SASI_Rn02_00239552 predicted 385
5 SASI_Rn02_00239553 predicted 391
6 SASI_Rn02_00239554 predicted 319
7 SASI_Rn02_00239555 predicted 898
8 SASI_Rn02_00239556 predicted 389
9 SASI_Rn02_00239557 predicted 939
10 SASI_Rn02_00239558 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145420 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155203 predicted 725
2 SASI_Mm01_00155204 predicted 485
3 SASI_Mm01_00155205 predicted 233
4 SASI_Mm01_00155206 predicted 555
5 SASI_Mm01_00155207 predicted 678
6 SASI_Mm01_00155208 predicted 468
7 SASI_Mm01_00155209 predicted 482
8 SASI_Mm01_00155210 predicted 753
9 SASI_Mm01_00155212 predicted 474
10 SASI_Mm02_00340768 predicted 287
11 SASI_Mm01_00155211 predicted 362
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145420
VALIDATED
UBE2D1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2D 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145420.2-370s21c1
Sequence:CCGGATAAACAGCAACGGGAGTATTCTCGAGAATACTCCCGTTGCTGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145420.1-520s21c1
Sequence:CCGGCGCAAGAGAATGGACTCAGAACTCGAGTTCTGAGTCCATTCTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145420.1-431s21c1
Sequence:CCGGTCGCTGCTCTGTGATCCTAATCTCGAGATTAGGATCACAGAGCAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145420.1-278s21c1
Sequence:CCGGCCGACAGACTATCCCTTTAAACTCGAGTTTAAAGGGATAGTCTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316952    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145420.1-1156s21c1
Sequence:CCGGGCACACTGTATTTCTCAGTATCTCGAGATACTGAGAAATACAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145420.1-457s21c1
Sequence:CCGGCGATCCCTTAGTACCAGATATCTCGAGATATCTGGTACTAAGGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145420.1-1156s1c1
Sequence:CCGGGCACACTGTATTTCTCAGTATCTCGAGATACTGAGAAATACAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145420.1-392s1c1
Sequence:CCGGCCCGCTTTGACTGTATCGAAACTCGAGTTTCGATACAGTCAAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145420.1-278s1c1
Sequence:CCGGCCGACAGACTATCCCTTTAAACTCGAGTTTAAAGGGATAGTCTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145420.1-331s1c1
Sequence:CCGGCCACCCAAATATAAACAGCAACTCGAGTTGCTGTTTATATTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145420.1-520s1c1
Sequence:CCGGCGCAAGAGAATGGACTCAGAACTCGAGTTCTGAGTCCATTCTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145420
VALIDATED
UBE2D1 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2D 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145420.2-370s21c1
Sequence:CCGGATAAACAGCAACGGGAGTATTCTCGAGAATACTCCCGTTGCTGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145420.1-520s21c1
Sequence:CCGGCGCAAGAGAATGGACTCAGAACTCGAGTTCTGAGTCCATTCTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145420.1-431s21c1
Sequence:CCGGTCGCTGCTCTGTGATCCTAATCTCGAGATTAGGATCACAGAGCAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145420.1-278s21c1
Sequence:CCGGCCGACAGACTATCCCTTTAAACTCGAGTTTAAAGGGATAGTCTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316952    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145420.1-1156s21c1
Sequence:CCGGGCACACTGTATTTCTCAGTATCTCGAGATACTGAGAAATACAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145420.1-457s21c1
Sequence:CCGGCGATCCCTTAGTACCAGATATCTCGAGATATCTGGTACTAAGGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145420.1-1156s1c1
Sequence:CCGGGCACACTGTATTTCTCAGTATCTCGAGATACTGAGAAATACAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145420.1-392s1c1
Sequence:CCGGCCCGCTTTGACTGTATCGAAACTCGAGTTTCGATACAGTCAAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145420.1-278s1c1
Sequence:CCGGCCGACAGACTATCCCTTTAAACTCGAGTTTAAAGGGATAGTCTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145420.1-331s1c1
Sequence:CCGGCCACCCAAATATAAACAGCAACTCGAGTTGCTGTTTATATTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145420.1-520s1c1
Sequence:CCGGCGCAAGAGAATGGACTCAGAACTCGAGTTCTGAGTCCATTCTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145420
VALIDATED
UBE2D1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2D 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145420.2-370s21c1
Sequence:CCGGATAAACAGCAACGGGAGTATTCTCGAGAATACTCCCGTTGCTGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145420.1-520s21c1
Sequence:CCGGCGCAAGAGAATGGACTCAGAACTCGAGTTCTGAGTCCATTCTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145420.1-431s21c1
Sequence:CCGGTCGCTGCTCTGTGATCCTAATCTCGAGATTAGGATCACAGAGCAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145420.1-278s21c1
Sequence:CCGGCCGACAGACTATCCCTTTAAACTCGAGTTTAAAGGGATAGTCTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316952    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145420.1-1156s21c1
Sequence:CCGGGCACACTGTATTTCTCAGTATCTCGAGATACTGAGAAATACAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145420.1-457s21c1
Sequence:CCGGCGATCCCTTAGTACCAGATATCTCGAGATATCTGGTACTAAGGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145420.1-1156s1c1
Sequence:CCGGGCACACTGTATTTCTCAGTATCTCGAGATACTGAGAAATACAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145420.1-392s1c1
Sequence:CCGGCCCGCTTTGACTGTATCGAAACTCGAGTTTCGATACAGTCAAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145420.1-278s1c1
Sequence:CCGGCCGACAGACTATCCCTTTAAACTCGAGTTTAAAGGGATAGTCTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145420.1-331s1c1
Sequence:CCGGCCACCCAAATATAAACAGCAACTCGAGTTGCTGTTTATATTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145420.1-520s1c1
Sequence:CCGGCGCAAGAGAATGGACTCAGAACTCGAGTTCTGAGTCCATTCTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003338
VALIDATED
UBE2D1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2D 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000272503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003338.3-1121s21c1
Sequence:CCGGTACATGTATGTCAACTCATTACTCGAGTAATGAGTTGACATACATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003338.3-370s21c1
Sequence:CCGGCTTCTTTCTCACTGTACATTTCTCGAGAAATGTACAGTGAGAAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003338.3-624s21c1
Sequence:CCGGACAACAGACATGCAAGAGAATCTCGAGATTCTCTTGCATGTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003338.3-580s21c1
Sequence:CCGGAGTACCAGATATTGCACAAATCTCGAGATTTGTGCAATATCTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003338.3-267s21c1
Sequence:CCGGGCGATCCACCTGCTCACTGTTCTCGAGAACAGTGAGCAGGTGGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003338.x-370s1c1
Sequence:CCGGCTTCTTTCTCACTGTACATTTCTCGAGAAATGTACAGTGAGAAAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003338.x-1604s1c1
Sequence:CCGGGCCATTAGTCACCATTAGTTACTCGAGTAACTAATGGTGACTAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003338.x-624s1c1
Sequence:CCGGACAACAGACATGCAAGAGAATCTCGAGATTCTCTTGCATGTCTGTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003338.x-267s1c1
Sequence:CCGGGCGATCCACCTGCTCACTGTTCTCGAGAACAGTGAGCAGGTGGATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003338.x-543s1c1
Sequence:CCGGGTTCTCTACTTTGTGATCCTACTCGAGTAGGATCACAAAGTAGAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003338
VALIDATED
UBE2D1 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2D 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000272503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003338.3-1121s21c1
Sequence:CCGGTACATGTATGTCAACTCATTACTCGAGTAATGAGTTGACATACATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003338.3-370s21c1
Sequence:CCGGCTTCTTTCTCACTGTACATTTCTCGAGAAATGTACAGTGAGAAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003338.3-624s21c1
Sequence:CCGGACAACAGACATGCAAGAGAATCTCGAGATTCTCTTGCATGTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003338.3-580s21c1
Sequence:CCGGAGTACCAGATATTGCACAAATCTCGAGATTTGTGCAATATCTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003338.3-267s21c1
Sequence:CCGGGCGATCCACCTGCTCACTGTTCTCGAGAACAGTGAGCAGGTGGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003338.x-370s1c1
Sequence:CCGGCTTCTTTCTCACTGTACATTTCTCGAGAAATGTACAGTGAGAAAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003338.x-1604s1c1
Sequence:CCGGGCCATTAGTCACCATTAGTTACTCGAGTAACTAATGGTGACTAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003338.x-624s1c1
Sequence:CCGGACAACAGACATGCAAGAGAATCTCGAGATTCTCTTGCATGTCTGTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003338.x-267s1c1
Sequence:CCGGGCGATCCACCTGCTCACTGTTCTCGAGAACAGTGAGCAGGTGGATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003338.x-543s1c1
Sequence:CCGGGTTCTCTACTTTGTGATCCTACTCGAGTAGGATCACAAAGTAGAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003338
VALIDATED
UBE2D1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2D 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000272503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003338.3-1121s21c1
Sequence:CCGGTACATGTATGTCAACTCATTACTCGAGTAATGAGTTGACATACATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003338.3-370s21c1
Sequence:CCGGCTTCTTTCTCACTGTACATTTCTCGAGAAATGTACAGTGAGAAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003338.3-624s21c1
Sequence:CCGGACAACAGACATGCAAGAGAATCTCGAGATTCTCTTGCATGTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003338.3-580s21c1
Sequence:CCGGAGTACCAGATATTGCACAAATCTCGAGATTTGTGCAATATCTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003338.3-267s21c1
Sequence:CCGGGCGATCCACCTGCTCACTGTTCTCGAGAACAGTGAGCAGGTGGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003338.x-370s1c1
Sequence:CCGGCTTCTTTCTCACTGTACATTTCTCGAGAAATGTACAGTGAGAAAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003338.x-1604s1c1
Sequence:CCGGGCCATTAGTCACCATTAGTTACTCGAGTAACTAATGGTGACTAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003338.x-624s1c1
Sequence:CCGGACAACAGACATGCAAGAGAATCTCGAGATTCTCTTGCATGTCTGTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003338.x-267s1c1
Sequence:CCGGGCGATCCACCTGCTCACTGTTCTCGAGAACAGTGAGCAGGTGGATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003338.x-543s1c1
Sequence:CCGGGTTCTCTACTTTGTGATCCTACTCGAGTAGGATCACAAAGTAGAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks