EMAIL THIS PAGE TO A FRIEND

UBE2D2

ubiquitin-conjugating enzyme E2D 2

Synonyms: E2(17)KB2 PUBC1 UBC4 UBC4/5 UBCH5B
UniProtKB ID: P62837, D3DQC9, P51669, Q3MN78, Q96RP6
Gene ID:
Human(7322) Summary: Regulated degradation of misfolded, damaged or short-lived proteins in eukaryotes occurs via the ubiquitin (Ub)-proteasome system (UPS). An integral part of the UPS system is the ubiquitination of target proteins and covalent linkage of Ub-containing proteins to form polymeric chains, marking them as targets for 26S proteasome-mediated degradation. Ubiquitination of proteins is mediated by a cascade of enzymes which includes E1 (ubiquitin activating), E2 (ubiquitin conjugating), and E3 (ubiquitin ligases) enzymes. This gene encodes a member of the E2 enzyme family. Substrates of this enzyme include the tumor suppressor protein p53 and peroxisomal biogenesis factor 5 (PEX5). Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Rat(641452) ubiquitin-conjugating enzyme E2D 2
chicken(416137) ubiquitin-conjugating enzyme E2D 2
domestic cat(101092081) ubiquitin-conjugating enzyme E2D 2
dog(612742) ubiquitin-conjugating enzyme E2D 2
domestic guinea pig(100732779) ubiquitin-conjugating enzyme E2D 2
naked mole-rat(101724153) ubiquitin-conjugating enzyme E2D 2
cow(541003) ubiquitin-conjugating enzyme E2D 2
172 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102620 Anti-UBE2D2 (ab1) antibody produced in rabbit affinity isolated antibody zebrafish, guinea pig, bovine, horse, pig, mouse, rabbit, human, canine, rat
western blot pricing
SAB2108016 Anti-UBE2D2 antibody produced in rabbit IgG fraction of antiserum human, bovine, guinea pig, horse, canine, mouse, rat, zebrafish, rabbit
immunohistochemistry, western blot pricing
AV43008 Anti-UBE2D2 antibody produced in rabbit IgG fraction of antiserum, lyophilized powder canine, human, mouse, rabbit, rat, horse, bovine, zebrafish
immunohistochemistry, western blot pricing
HPA003920 Anti-UBE2D4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
WH0007322M2 Monoclonal Anti-UBE2D2 antibody produced in mouse clone 4A1, purified immunoglobulin, buffered aqueous solution mouse, rat, human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003339 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003339 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003339 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063521 MISSION® esiRNA esiRNA human UBE2D2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003339 Rosetta Predictions human pricing
NM_181838 Rosetta Predictions human pricing
NM_001037292 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228722 predicted 983
2 SASI_Hs01_00228723 predicted 1238
3 SASI_Hs01_00228724 predicted 1138
4 SASI_Hs01_00228725 predicted 1044
5 SASI_Hs01_00228726 predicted 1243
6 SASI_Hs02_00335490 predicted 1215
7 SASI_Hs01_00228727 predicted 1211
8 SASI_Hs01_00228728 predicted 929
9 SASI_Hs01_00228729 predicted 1306
10 SASI_Hs01_00228730 predicted 1076
11 SASI_Hs01_00228731 predicted 1318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116650 predicted 1145
2 SASI_Hs01_00116651 predicted 1404
3 SASI_Hs01_00116652 predicted 1298
4 SASI_Hs01_00116653 predicted 1210
5 SASI_Hs01_00116654 predicted 1416
6 SASI_Hs02_00370428 predicted 1375
7 SASI_Hs01_00116655 predicted 1374
8 SASI_Hs01_00116656 predicted 1088
9 SASI_Hs01_00116657 predicted 1465
10 SASI_Hs01_00116658 predicted 1243
11 SASI_Hs01_00116659 predicted 1484
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037292 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067741 predicted 688
2 SASI_Rn01_00067742 predicted 404
3 SASI_Rn01_00067743 predicted 583
4 SASI_Rn01_00067744 predicted 692
5 SASI_Rn01_00067745 predicted 666
6 SASI_Rn01_00067746 predicted 664
7 SASI_Rn01_00067748 predicted 679
8 SASI_Rn01_00067749 predicted 531
9 SASI_Rn01_00067750 predicted 675
10 SASI_Rn02_00204359 predicted 552
11 SASI_Rn01_00067747 predicted 508
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003339
VALIDATED
UBE2D2 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2D 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003339.x-907s1c1
Sequence:CCGGCTCCAGCACTAACTATTTCAACTCGAGTTGAAATAGTTAGTGCTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003339.x-946s1c1
Sequence:CCGGGTTCTCTGTTGTGTGATCCCACTCGAGTGGGATCACACAACAGAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003339.2-937s21c1
Sequence:CCGGTGTCCATCTGTTCTCTGTTGTCTCGAGACAACAGAGAACAGATGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003339.2-2004s21c1
Sequence:CCGGGCTGAGATTAGTGGTGGATTTCTCGAGAAATCCACCACTAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003339.2-756s21c1
Sequence:CCGGCCCTATCAGGGTGGAGTATTTCTCGAGAAATACTCCACCCTGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003339.2-946s21c1
Sequence:CCGGGTTCTCTGTTGTGTGATCCCACTCGAGTGGGATCACACAACAGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003339
VALIDATED
UBE2D2 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2D 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003339.x-907s1c1
Sequence:CCGGCTCCAGCACTAACTATTTCAACTCGAGTTGAAATAGTTAGTGCTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003339.x-946s1c1
Sequence:CCGGGTTCTCTGTTGTGTGATCCCACTCGAGTGGGATCACACAACAGAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003339.2-937s21c1
Sequence:CCGGTGTCCATCTGTTCTCTGTTGTCTCGAGACAACAGAGAACAGATGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003339.2-2004s21c1
Sequence:CCGGGCTGAGATTAGTGGTGGATTTCTCGAGAAATCCACCACTAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003339.2-756s21c1
Sequence:CCGGCCCTATCAGGGTGGAGTATTTCTCGAGAAATACTCCACCCTGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003339.2-946s21c1
Sequence:CCGGGTTCTCTGTTGTGTGATCCCACTCGAGTGGGATCACACAACAGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003339
VALIDATED
UBE2D2 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2D 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003339.x-907s1c1
Sequence:CCGGCTCCAGCACTAACTATTTCAACTCGAGTTGAAATAGTTAGTGCTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003339.x-946s1c1
Sequence:CCGGGTTCTCTGTTGTGTGATCCCACTCGAGTGGGATCACACAACAGAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003339.2-937s21c1
Sequence:CCGGTGTCCATCTGTTCTCTGTTGTCTCGAGACAACAGAGAACAGATGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003339.2-2004s21c1
Sequence:CCGGGCTGAGATTAGTGGTGGATTTCTCGAGAAATCCACCACTAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003339.2-756s21c1
Sequence:CCGGCCCTATCAGGGTGGAGTATTTCTCGAGAAATACTCCACCCTGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003339.2-946s21c1
Sequence:CCGGGTTCTCTGTTGTGTGATCCCACTCGAGTGGGATCACACAACAGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks