EMAIL THIS PAGE TO A FRIEND

UBE2D3

ubiquitin-conjugating enzyme E2D 3

Synonyms: E2(17)KB3 UBC4/5 UBCH5C
Gene ID:
Human(7323) Summary: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme functions in the ubiquitination of the tumor-suppressor protein p53, which is induced by an E3 ubiquitin-protein ligase. Multiple spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(66105) ubiquitin-conjugating enzyme E2D 3
Rat(81920) ubiquitin-conjugating enzyme E2D 3
Zebrafish(321832) ubiquitin-conjugating enzyme E2D 3
domestic cat(101094845) ubiquitin-conjugating enzyme E2D 3
chicken(422713) ubiquitin-conjugating enzyme E2D 3
cow(326583) ubiquitin-conjugating enzyme E2D 3
sheep(101107195) ubiquitin-conjugating enzyme E2D 3
naked mole-rat(101725641) ubiquitin-conjugating enzyme E2D 3
domestic guinea pig(100730907) ubiquitin-conjugating enzyme E2D 3
241 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102621 Anti-UBE2D2 (ab2) antibody produced in rabbit affinity isolated antibody , human, rabbit, sheep, mouse, pig, guinea pig, Caenorhabditis elegans, rat, horse
western blot pricing
SAB4301817 Anti-UBE2D3 affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB2102622 Anti-UBE2D3 antibody produced in rabbit affinity isolated antibody canine, mouse, bovine, pig, human, rabbit, zebrafish, guinea pig, rat, horse
western blot pricing
WH0007323M1 Monoclonal Anti-UBE2D3 antibody produced in mouse clone 4C1-1E3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404505 Monoclonal Anti-UBE2D3 antibody produced in mouse clone S2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025356 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025356 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025356 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003340 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003340 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003340 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003340 Rosetta Predictions human pricing
NM_181886 Rosetta Predictions human pricing
NM_181887 Rosetta Predictions human pricing
NM_181888 Rosetta Predictions human pricing
NM_181889 Rosetta Predictions human pricing
NM_181890 Rosetta Predictions human pricing
NM_181891 Rosetta Predictions human pricing
NM_181892 Rosetta Predictions human pricing
NM_181893 Rosetta Predictions human pricing
NM_031237 Rosetta Predictions rat pricing
NM_025356 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003340 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192688 predicted 1436
2 SASI_Hs01_00192689 predicted 1409
3 SASI_Hs01_00192690 predicted 1434
4 SASI_Hs01_00192691 predicted 1227
5 SASI_Hs01_00192692 predicted 854
6 SASI_Hs01_00192693 predicted 613
7 SASI_Hs01_00192694 predicted 616
8 SASI_Hs01_00192695 predicted 925
9 SASI_Hs01_00192696 predicted 1234
10 SASI_Hs01_00192697 predicted 1098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181886 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172686 predicted 1646
2 SASI_Hs01_00172687 predicted 1619
3 SASI_Hs01_00172688 predicted 1639
4 SASI_Hs01_00172689 predicted 1439
5 SASI_Hs01_00172690 predicted 1053
6 SASI_Hs01_00172691 predicted 820
7 SASI_Hs01_00172692 predicted 831
8 SASI_Hs01_00172693 predicted 1137
9 SASI_Hs01_00172694 predicted 1436
10 SASI_Hs01_00172695 predicted 1302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181887 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145513 predicted 1409
2 SASI_Hs01_00145514 predicted 1380
3 SASI_Hs01_00145515 predicted 1406
4 SASI_Hs01_00145516 predicted 1198
5 SASI_Hs01_00145517 predicted 825
6 SASI_Hs01_00145518 predicted 593
7 SASI_Hs01_00145519 predicted 597
8 SASI_Hs01_00145520 predicted 902
9 SASI_Hs01_00145521 predicted 1202
10 SASI_Hs01_00145522 predicted 1065
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181888 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108601 predicted 1284
2 SASI_Hs01_00108602 predicted 1265
3 SASI_Hs01_00108603 predicted 1283
4 SASI_Hs01_00108604 predicted 1086
5 SASI_Hs01_00108605 predicted 707
6 SASI_Hs01_00108606 predicted 469
7 SASI_Hs01_00108607 predicted 470
8 SASI_Hs01_00108608 predicted 781
9 SASI_Hs01_00108609 predicted 1081
10 SASI_Hs01_00108610 predicted 954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181889 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069242 predicted 1276
2 SASI_Hs01_00069243 predicted 1258
3 SASI_Hs01_00069244 predicted 1283
4 SASI_Hs01_00069245 predicted 1080
5 SASI_Hs01_00069246 predicted 695
6 SASI_Hs01_00069247 predicted 465
7 SASI_Hs01_00069248 predicted 468
8 SASI_Hs01_00069249 predicted 770
9 SASI_Hs01_00069250 predicted 1080
10 SASI_Hs01_00069251 predicted 938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181890 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017004 predicted 1233
2 SASI_Hs01_00017005 predicted 1208
3 SASI_Hs01_00017006 predicted 1235
4 SASI_Hs01_00017007 predicted 1028
5 SASI_Hs01_00017008 predicted 648
6 SASI_Hs01_00017009 predicted 420
7 SASI_Hs01_00017010 predicted 416
8 SASI_Hs01_00017011 predicted 728
9 SASI_Hs01_00017012 predicted 1028
10 SASI_Hs01_00017013 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210936 predicted 1193
2 SASI_Hs01_00210937 predicted 1169
3 SASI_Hs01_00210938 predicted 1202
4 SASI_Hs01_00210939 predicted 992
5 SASI_Hs01_00210940 predicted 618
6 SASI_Hs01_00210941 predicted 377
7 SASI_Hs01_00210942 predicted 388
8 SASI_Hs01_00210943 predicted 686
9 SASI_Hs01_00210944 predicted 994
10 SASI_Hs01_00210945 predicted 859
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181892 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115745 predicted 1037
2 SASI_Hs01_00115747 predicted 1046
3 SASI_Hs01_00115748 predicted 1067
4 SASI_Hs01_00115739 predicted 986
5 SASI_Hs01_00115740 predicted 761
6 SASI_Hs01_00115741 predicted 762
7 SASI_Hs01_00115742 predicted 1118
8 SASI_Hs01_00115743 predicted 999
9 SASI_Hs01_00115744 predicted 1156
10 SASI_Hs01_00115746 predicted 753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181893 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087240 predicted 1050
2 SASI_Hs01_00087241 predicted 1025
3 SASI_Hs01_00087242 predicted 1057
4 SASI_Hs01_00087243 predicted 854
5 SASI_Hs01_00087244 predicted 472
6 SASI_Hs01_00087245 predicted 233
7 SASI_Hs01_00087246 predicted 243
8 SASI_Hs01_00087247 predicted 541
9 SASI_Hs01_00087248 predicted 850
10 SASI_Hs01_00087249 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031237 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097431 predicted 1209
2 SASI_Rn01_00097432 predicted 1211
3 SASI_Rn01_00097434 predicted 1162
4 SASI_Rn01_00097435 predicted 1157
5 SASI_Rn01_00097436 predicted 1170
6 SASI_Rn01_00097437 predicted 398
7 SASI_Rn01_00097438 predicted 1162
8 SASI_Rn02_00264514 predicted 1210
9 SASI_Rn01_00097439 predicted 379
10 SASI_Rn01_00097440 predicted 394
11 SASI_Rn01_00097433 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025356 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101156 predicted 1115
2 SASI_Mm01_00101157 predicted 1174
3 SASI_Mm01_00101158 predicted 243
4 SASI_Mm02_00328041 predicted 1132
5 SASI_Mm01_00101160 predicted 1128
6 SASI_Mm01_00101161 predicted 1175
7 SASI_Mm02_00328042 predicted 1130
8 SASI_Mm02_00328043 predicted 1127
9 SASI_Mm02_00328044 predicted 513
10 SASI_Mm01_00101165 predicted 1061
11 SASI_Mm01_00101159 predicted 364
12 SASI_Mm01_00101162 predicted 349
13 SASI_Mm01_00101163 predicted 366
14 SASI_Mm01_00101164 predicted 371
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025356
VALIDATED
UBE2D3 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2D 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025356.2-366s1c1
Sequence:CCGGGCCCATATCAAGGTGGTGTATCTCGAGATACACCACCTTGATATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025356.2-419s1c1
Sequence:CCGGCCCTTCAAACCACCTAAGGTTCTCGAGAACCTTAGGTGGTTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025356.2-628s1c1
Sequence:CCGGCAGAGATAAGTACAACAGAATCTCGAGATTCTGTTGTACTTATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025356.2-519s1c1
Sequence:CCGGCTCCTGCTTTAACTATTTCTACTCGAGTAGAAATAGTTAAAGCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025356.4-599s21c1
Sequence:CCGGCAGAGATTGCACGGATCTATACTCGAGTATAGATCCGTGCAATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025356.4-1147s21c1
Sequence:CCGGGATATACTTTATGCTCATAACCTCGAGGTTATGAGCATAAAGTATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025356.4-627s21c1
Sequence:CCGGCAGAGATAAGTACAACAGAATCTCGAGATTCTGTTGTACTTATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025356.4-481s21c1
Sequence:CCGGGGCAGCATTTGTCTTGATATTCTCGAGAATATCAAGACAAATGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025356.4-330s21c1
Sequence:CCGGTCATTGGCAAGCCACAATTATCTCGAGATAATTGTGGCTTGCCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025356
VALIDATED
UBE2D3 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2D 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025356.2-366s1c1
Sequence:CCGGGCCCATATCAAGGTGGTGTATCTCGAGATACACCACCTTGATATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025356.2-419s1c1
Sequence:CCGGCCCTTCAAACCACCTAAGGTTCTCGAGAACCTTAGGTGGTTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025356.2-628s1c1
Sequence:CCGGCAGAGATAAGTACAACAGAATCTCGAGATTCTGTTGTACTTATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025356.2-519s1c1
Sequence:CCGGCTCCTGCTTTAACTATTTCTACTCGAGTAGAAATAGTTAAAGCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025356.4-599s21c1
Sequence:CCGGCAGAGATTGCACGGATCTATACTCGAGTATAGATCCGTGCAATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025356.4-1147s21c1
Sequence:CCGGGATATACTTTATGCTCATAACCTCGAGGTTATGAGCATAAAGTATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025356.4-627s21c1
Sequence:CCGGCAGAGATAAGTACAACAGAATCTCGAGATTCTGTTGTACTTATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025356.4-481s21c1
Sequence:CCGGGGCAGCATTTGTCTTGATATTCTCGAGAATATCAAGACAAATGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025356.4-330s21c1
Sequence:CCGGTCATTGGCAAGCCACAATTATCTCGAGATAATTGTGGCTTGCCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025356
VALIDATED
UBE2D3 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2D 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025356.2-366s1c1
Sequence:CCGGGCCCATATCAAGGTGGTGTATCTCGAGATACACCACCTTGATATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025356.2-419s1c1
Sequence:CCGGCCCTTCAAACCACCTAAGGTTCTCGAGAACCTTAGGTGGTTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025356.2-628s1c1
Sequence:CCGGCAGAGATAAGTACAACAGAATCTCGAGATTCTGTTGTACTTATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025356.2-519s1c1
Sequence:CCGGCTCCTGCTTTAACTATTTCTACTCGAGTAGAAATAGTTAAAGCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025356.4-599s21c1
Sequence:CCGGCAGAGATTGCACGGATCTATACTCGAGTATAGATCCGTGCAATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025356.4-1147s21c1
Sequence:CCGGGATATACTTTATGCTCATAACCTCGAGGTTATGAGCATAAAGTATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025356.4-627s21c1
Sequence:CCGGCAGAGATAAGTACAACAGAATCTCGAGATTCTGTTGTACTTATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025356.4-481s21c1
Sequence:CCGGGGCAGCATTTGTCTTGATATTCTCGAGAATATCAAGACAAATGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025356.4-330s21c1
Sequence:CCGGTCATTGGCAAGCCACAATTATCTCGAGATAATTGTGGCTTGCCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003340
VALIDATED
UBE2D3 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2D 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003340.4-770s1c1
Sequence:CCGGGCCTGCTTTAACAATTTCTAACTCGAGTTAGAAATTGTTAAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003340.4-849s1c1
Sequence:CCGGCCAGAGATTGCACGGATCTATCTCGAGATAGATCCGTGCAATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003340.4-617s1c1
Sequence:CCGGCCCATATCAAGGCGGTGTATTCTCGAGAATACACCGCCTTGATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003340.4-591s1c1
Sequence:CCGGGCCACAATTATGGGACCTAATCTCGAGATTAGGTCCCATAATTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003340.4-955s1c1
Sequence:CCGGCCTGCATTATAGCTGGAATAACTCGAGTTATTCCAGCTATAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003340.5-807s21c1
Sequence:CCGGTCACTGCTATGTGATCCAAACCTCGAGGTTTGGATCACATAGCAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003340.5-879s21c1
Sequence:CCGGGATAAGTACAACAGAATATCTCTCGAGAGATATTCTGTTGTACTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003340.5-894s21c1
Sequence:CCGGATATCTCGGGAATGGACTCAGCTCGAGCTGAGTCCATTCCCGAGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003340.5-941s21c1
Sequence:CCGGAGTCAGAATAACCTGCATTATCTCGAGATAATGCAGGTTATTCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003340.5-1423s21c1
Sequence:CCGGGTGGCTGGAGAATTGGTATTGCTCGAGCAATACCAATTCTCCAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003340.5-921s21c1
Sequence:CCGGGCCATGTGATGCTACCTTAAACTCGAGTTTAAGGTAGCATCACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003340
VALIDATED
UBE2D3 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2D 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003340.4-770s1c1
Sequence:CCGGGCCTGCTTTAACAATTTCTAACTCGAGTTAGAAATTGTTAAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003340.4-849s1c1
Sequence:CCGGCCAGAGATTGCACGGATCTATCTCGAGATAGATCCGTGCAATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003340.4-617s1c1
Sequence:CCGGCCCATATCAAGGCGGTGTATTCTCGAGAATACACCGCCTTGATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003340.4-591s1c1
Sequence:CCGGGCCACAATTATGGGACCTAATCTCGAGATTAGGTCCCATAATTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003340.4-955s1c1
Sequence:CCGGCCTGCATTATAGCTGGAATAACTCGAGTTATTCCAGCTATAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003340.5-807s21c1
Sequence:CCGGTCACTGCTATGTGATCCAAACCTCGAGGTTTGGATCACATAGCAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003340.5-879s21c1
Sequence:CCGGGATAAGTACAACAGAATATCTCTCGAGAGATATTCTGTTGTACTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003340.5-894s21c1
Sequence:CCGGATATCTCGGGAATGGACTCAGCTCGAGCTGAGTCCATTCCCGAGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003340.5-941s21c1
Sequence:CCGGAGTCAGAATAACCTGCATTATCTCGAGATAATGCAGGTTATTCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003340.5-1423s21c1
Sequence:CCGGGTGGCTGGAGAATTGGTATTGCTCGAGCAATACCAATTCTCCAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003340.5-921s21c1
Sequence:CCGGGCCATGTGATGCTACCTTAAACTCGAGTTTAAGGTAGCATCACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003340
VALIDATED
UBE2D3 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2D 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003340.4-770s1c1
Sequence:CCGGGCCTGCTTTAACAATTTCTAACTCGAGTTAGAAATTGTTAAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003340.4-849s1c1
Sequence:CCGGCCAGAGATTGCACGGATCTATCTCGAGATAGATCCGTGCAATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003340.4-617s1c1
Sequence:CCGGCCCATATCAAGGCGGTGTATTCTCGAGAATACACCGCCTTGATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003340.4-591s1c1
Sequence:CCGGGCCACAATTATGGGACCTAATCTCGAGATTAGGTCCCATAATTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003340.4-955s1c1
Sequence:CCGGCCTGCATTATAGCTGGAATAACTCGAGTTATTCCAGCTATAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003340.5-807s21c1
Sequence:CCGGTCACTGCTATGTGATCCAAACCTCGAGGTTTGGATCACATAGCAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003340.5-879s21c1
Sequence:CCGGGATAAGTACAACAGAATATCTCTCGAGAGATATTCTGTTGTACTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003340.5-894s21c1
Sequence:CCGGATATCTCGGGAATGGACTCAGCTCGAGCTGAGTCCATTCCCGAGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003340.5-941s21c1
Sequence:CCGGAGTCAGAATAACCTGCATTATCTCGAGATAATGCAGGTTATTCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003340.5-1423s21c1
Sequence:CCGGGTGGCTGGAGAATTGGTATTGCTCGAGCAATACCAATTCTCCAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003340.5-921s21c1
Sequence:CCGGGCCATGTGATGCTACCTTAAACTCGAGTTTAAGGTAGCATCACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks