EMAIL THIS PAGE TO A FRIEND

UBE2D4

ubiquitin-conjugating enzyme E2D 4 (putative)

Synonyms: HBUCE1
UniProtKB ID: Q9Y2X8, A4D1V0
Gene ID:
Mouse(546638) ubiquitin-conjugating enzyme E2D 4
Rat(79435) ubiquitin-conjugating enzyme E2D 4 (putative)
Zebrafish(100001914) ubiquitin-conjugating enzyme E2D 4 (putative)
domestic guinea pig(100729437) ubiquitin-conjugating enzyme E2D 4 (putative)
naked mole-rat(101725736) ubiquitin-conjugating enzyme E2D 4 (putative)
cow(511801) ubiquitin-conjugating enzyme E2D 4 (putative)
sheep(101122634) ubiquitin-conjugating enzyme E2D 4 (putative)
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015983 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015983 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015983 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU143341 MISSION® esiRNA esiRNA human UBE2D4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015983 Rosetta Predictions human pricing
NM_031001 Rosetta Predictions rat pricing
XM_621400 Rosetta Predictions mouse pricing
XM_905852 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015983 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206454 predicted 671
2 SASI_Hs01_00206455 predicted 987
3 SASI_Hs01_00206457 predicted 965
4 SASI_Hs01_00206458 predicted 547
5 SASI_Hs01_00206459 predicted 299
6 SASI_Hs01_00206460 predicted 698
7 SASI_Hs01_00206461 predicted 702
8 SASI_Hs01_00206463 predicted 613
9 SASI_Hs02_00348656 predicted 451
10 SASI_Hs02_00348657 predicted 718
11 SASI_Hs01_00206456 predicted 761
12 SASI_Hs01_00206462 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031001 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061563 predicted 337
2 SASI_Rn01_00061564 predicted 266
3 SASI_Rn01_00061565 predicted 805
4 SASI_Rn01_00061566 predicted 758
5 SASI_Rn01_00061567 predicted 802
6 SASI_Rn01_00061568 predicted 886
7 SASI_Rn01_00061569 predicted 620
8 SASI_Rn01_00061570 predicted 807
9 SASI_Rn01_00061571 predicted 335
10 SASI_Rn01_00061572 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_621400 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00427781 predicted 242
2 SASI_Mm02_00427782 predicted 206
3 SASI_Mm02_00427783 predicted 263
4 SASI_Mm02_00427784 predicted 247
5 SASI_Mm02_00427785 predicted 203
6 SASI_Mm02_00427786 predicted 217
7 SASI_Mm02_00427787 predicted 247
8 SASI_Mm02_00427788 predicted 193
9 SASI_Mm02_00427789 predicted 263
10 SASI_Mm02_00427790 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_905852 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00432158 predicted 243
2 SASI_Mm02_00432159 predicted 207
3 SASI_Mm02_00432160 predicted 258
4 SASI_Mm02_00432161 predicted 250
5 SASI_Mm02_00432162 predicted 209
6 SASI_Mm02_00432163 predicted 213
7 SASI_Mm02_00432164 predicted 243
8 SASI_Mm02_00432165 predicted 193
9 SASI_Mm02_00432166 predicted 261
10 SASI_Mm02_00432167 predicted 207
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015983
VALIDATED
UBE2D4 MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2D 4 (putative)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015983.2-244s21c1
Sequence:CCGGCATCCACTTTCCTACAGATTACTCGAGTAATCTGTAGGAAAGTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015983.2-494s21c1
Sequence:CCGGCTAGCAAGAGAGTGGACACAACTCGAGTTGTGTCCACTCTCTTGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015983.2-1233s21c1
Sequence:CCGGCTAGAGATTTGGGTCATGTTACTCGAGTAACATGACCCAAATCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015983.2-341s21c1
Sequence:CCGGCTTGATATCCTGCGGTCTCAGCTCGAGCTGAGACCGCAGGATATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015983.2-154s21c1
Sequence:CCGGAGGACCTGTCGGTGATGACTTCTCGAGAAGTCATCACCGACAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015983.x-470s1c1
Sequence:CCGGGCCGACAGAGAGAAGTACAACCTCGAGGTTGTACTTCTCTCTGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015983.x-308s1c1
Sequence:CCGGCACCCTAATATCAACAGCAATCTCGAGATTGCTGTTGATATTAGGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015983.x-1233s1c1
Sequence:CCGGCTAGAGATTTGGGTCATGTTACTCGAGTAACATGACCCAAATCTCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015983.x-306s1c1
Sequence:CCGGATCACCCTAATATCAACAGCACTCGAGTGCTGTTGATATTAGGGTGATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015983.x-466s1c1
Sequence:CCGGCAAGGCCGACAGAGAGAAGTACTCGAGTACTTCTCTCTGTCGGCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015983
VALIDATED
UBE2D4 MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2D 4 (putative)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015983.2-244s21c1
Sequence:CCGGCATCCACTTTCCTACAGATTACTCGAGTAATCTGTAGGAAAGTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015983.2-494s21c1
Sequence:CCGGCTAGCAAGAGAGTGGACACAACTCGAGTTGTGTCCACTCTCTTGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015983.2-1233s21c1
Sequence:CCGGCTAGAGATTTGGGTCATGTTACTCGAGTAACATGACCCAAATCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015983.2-341s21c1
Sequence:CCGGCTTGATATCCTGCGGTCTCAGCTCGAGCTGAGACCGCAGGATATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015983.2-154s21c1
Sequence:CCGGAGGACCTGTCGGTGATGACTTCTCGAGAAGTCATCACCGACAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015983.x-470s1c1
Sequence:CCGGGCCGACAGAGAGAAGTACAACCTCGAGGTTGTACTTCTCTCTGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015983.x-308s1c1
Sequence:CCGGCACCCTAATATCAACAGCAATCTCGAGATTGCTGTTGATATTAGGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015983.x-1233s1c1
Sequence:CCGGCTAGAGATTTGGGTCATGTTACTCGAGTAACATGACCCAAATCTCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015983.x-306s1c1
Sequence:CCGGATCACCCTAATATCAACAGCACTCGAGTGCTGTTGATATTAGGGTGATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015983.x-466s1c1
Sequence:CCGGCAAGGCCGACAGAGAGAAGTACTCGAGTACTTCTCTCTGTCGGCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015983
VALIDATED
UBE2D4 MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2D 4 (putative)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015983.2-244s21c1
Sequence:CCGGCATCCACTTTCCTACAGATTACTCGAGTAATCTGTAGGAAAGTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015983.2-494s21c1
Sequence:CCGGCTAGCAAGAGAGTGGACACAACTCGAGTTGTGTCCACTCTCTTGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015983.2-1233s21c1
Sequence:CCGGCTAGAGATTTGGGTCATGTTACTCGAGTAACATGACCCAAATCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015983.2-341s21c1
Sequence:CCGGCTTGATATCCTGCGGTCTCAGCTCGAGCTGAGACCGCAGGATATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015983.2-154s21c1
Sequence:CCGGAGGACCTGTCGGTGATGACTTCTCGAGAAGTCATCACCGACAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015983.x-470s1c1
Sequence:CCGGGCCGACAGAGAGAAGTACAACCTCGAGGTTGTACTTCTCTCTGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015983.x-308s1c1
Sequence:CCGGCACCCTAATATCAACAGCAATCTCGAGATTGCTGTTGATATTAGGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015983.x-1233s1c1
Sequence:CCGGCTAGAGATTTGGGTCATGTTACTCGAGTAACATGACCCAAATCTCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015983.x-306s1c1
Sequence:CCGGATCACCCTAATATCAACAGCACTCGAGTGCTGTTGATATTAGGGTGATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015983.x-466s1c1
Sequence:CCGGCAAGGCCGACAGAGAGAAGTACTCGAGTACTTCTCTCTGTCGGCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks